Nucleus is where dna is stored and where rna transcription occurs

Answers

Answer 1

Answer:

Yes that is correct

Explanation:


Related Questions

According to kirk smith a professor of environmental health at the university of california berkley indoor fires increase risks of pneumonia tuberculosis lung cancer and low birth weight in babies born of women expose during pregnancy. What simple solution is being widely promoted to reduce the risk of death?
a) preparing meals using solar cookers.
b) switching from wood to burning crop waste as a fuel source.
c) adding more windows to houses as a source of ventilation.
d) passing a green tax to make homeowners pay for their pollution.
e) providing asthma inhalers to children under the age of 12 years.

Answers

Answer:

preparing meals using solar cookers.

Explanation:

solar cookers  radiates at low rates.Therefore the most of the nutrients in the foods are conserved.Thus most micro nutrients for biochemical activities are retained. Vitamins which can not withstand high temperature are preserved.

Most importantly carcinogens which are usually associated with high heat foods are avoided ,when cook with low heat of solar cookers

The solar cooker is smoke free,therefore irritation of the lungs,lung cancer associated with high heat  cookers is avoided.

Specifically,local Mayan women exposed to high heat smoke cookers, suffers lung cancer,and those with pregnancy gives to infants with low birth weights. Children exposed to theses high heat also experienced acute lower respiratory infections.

Thus the smokeless,low heat solar cooker is safer.

If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds

Answers

Answer:

The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.

The pygmy shrew is the smallest mammal in North America. However, when comparing the amount of
food eaten to its body weight, the pygmy shrew eats more food than any other mammal. It will
consume two to three times its own body weight in food daily. One explanation is that the pygmy
shrew uses energy at a high rate. In fact, its heart beats over one thousand times per minute.
What is the best explanation for what happens to the food's mass and energy when it is consumed by
the pygmy shrew?
A. The mass is mostly excreted as waste. The
energy is burned up and destroyed by the
pygmy shrew's high rate of cellular respiration.
B. The mass is all used for creating new mass in
growth. The energy is stored, used in cellular
respiration, or lost to the environment as heat.
C. The mass is used for growth, stored, or excreted
as waste. The energy is stored, used in cellular
respiration, and lost to the environment as heat.
D. The mass is used for growth, stored, or excreted
as waste. The energy is burned up and
destroyed by the shrew's high rate of cellular
respiration

Answers

Answer:

C. The mass is used for growth, stored, or excreted

as waste. The energy is stored, used in cellular

respiration, and lost to the environment as heat.

Explanation:

I got it right on the quiz.

Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).

How Pygmy shrew uses its food for energy?

The pygmy shrew has a large appetite which is a result of small body mass, rapid heat loss and high metabolic rate. It is kept in captivity which provides some idea of ​​the energy requirements of the species.

The pygmy shrew has such a high metabolism that it must eat at least every 30 minutes otherwise it will die. This can be explained by food mass and energy is that due to very high metabolism most of the food mass which is rapidly used up to form shrew, and a large proportion of the food is lost from the body surface because of its very small size.

The combination of these two factors are

1. A very high metabolism which is rapidly utilizes food material, and generates large amounts of heat in a very short period of time.

2. Very small size due to which high surface area to volume ratio leading to heat loss.

Thus, Mass used for growth, stored or excreted as waste. Energy is stored that is used in cellular respiration which is lost to the environment in the form of heat. So, the correct option is (C).

Learn more about Metabolism, here:

https://brainly.com/question/29763323

#SPJ2

I need help FAST!! U have too match the letters with the #.!

Answers

8 B

9 B

10 D

11 C

12 C

13 B

14 A

15 A

16 C

17 A

18 A

19 D

20 A

21 D

22 D

Biochemical and genetic experiments have demonstrated that the _________ of tRNA are important for recognition by its cognate aminotransferase-tRNA synthetase.

Answers

Answer:  Acceptor stem and anticodon loop.

Explanation:

Transfer RNA (tRNA) is a small RNA nucleic acid involved in protein synthesis (translation). Each tRNA molecule has two important areas:

A region of trinucleotides, called the anticodon A region where a specific amino acid binds.

During translation, the ribosome reads the sequence of the mRNA in groups of three bases to assemble the protein. So, in the mRNA chain there are codons, set of three bases, which determine the amino acid to be added to the peptide chain. The tRNA transfers the amino acid to the ribosomes, and then arranges them along the messenger RNA (mRNA) molecule. Then, the tRNA must have an anticodon that is complementary to the codon. Each type of tRNA is specifically combined with 1 of the 20 amino acids to be incorporated into proteins.

This means, during translation, each time an amino acid is added to the growing chain, a tRNA molecule is formed whose base pairs have a complementary sequence with mRNA molecule, ensuring that the appropriate amino acid is inserted into the protein. So, tRNA is a key link between RNA transcription and the translation of that RNA into protein. On the other hand, aminotransferases are enzymes responsible for attaching amino acids to the 3ʹ‐end of cognate tRNAs.

The acceptor stem is the site of attachment of amino acids to tRNA, and anticodon loop is the site of tRNA that is complementary to the codons found in mRNA (that determine the amino acid that will be added) This means, both parts are important for recognition, because the acceptor stem is where the amino acid is, and the anticodon loop ensures that the appropriate amino acid is inserted into the protein.

Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin. What kind of a cell is this?

Answers

Answer:

An animal cell in the telophase

Explanation:

Telophase is one of the stages of cell division in animal cell .

In the animal cell during telophase, Centrioles have pulled the chromosomes all the way to the spindle poles, the process of cleavage furrowing appears to be about to begin because the nuclear membrane and nucleoli reform, cytokinesis is almost coming to completion and the chromosomes eventually uncoil to chromatin. Usually cytokinesis occurs during telophase.

what is sexual reproduction

Answers

Answer:

See explanation below...

Explanation:

Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete with a single set of chromosomes combines with another to produce an organism composed of cells with two sets of chromosomes.

Best Regards!

Answer:

the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).

A mangrove swamp is more likely to exist along shores of which location?

Answers

They are likely to exist in tropical and subtropical tidal areas

Why do you think premenopausal women need more iron than
men of the same age?

Answers

Answer:

Women need more iron than men to make up for the amount of iron they lose in their menstrual period.

Explanation:

Answer:

Premenopausal women shed blood as part of menstruation every month, which lowers the level of iron in the body. So, they need more iron than men and are also at a greater risk for this nutritional deficiency.

PLATO

Explanation:

Assume that the allele for curly tail is completely dominant to the allele for straight tail for an X-linked maternal effect gene. Which of the following can be true?

a. In order for a female to be curly tailed, her father must be curly tailed.
b. A straight tailed male must have a straight tailed mother
c. mother with a straight tail cannot have progeny with curly tails
d. A male with a curly tail received a straight tail allele from his mother.

Answers

Answer:

A

Explanation:

In order for a female to be curly tailed, her father must be curly tailed.

I was finishing Summer B Plato Biology for High School when the program closed. All I had left to finish was my final. Does anyone have sample questions of the final I can study? I am bummed!

Answers

Study for the test and I will be there by a few minutes late but I will be in touch with you and the rest of the week and I have a few questions for the weak narrator is the same as last time we talked enough.

what are 3 major functions of the femur?

Answers

Answer:

The femur is the longest bone in the human skeleton. It functions in supporting the weight of the body and allowing motion of the leg. The femur articulates proximally with the acetabulum of the pelvis forming the hip joint, and distally with the tibia and patella to form the knee joint.

Explanation:

Holding the body weight once standing and moving. People are being stabilized as they move. Connecting the hips and knees' muscles, tendons, and ligaments to the rest of your body. These are three functions of femur.

What is femur?

The femur is the bone in the thigh. It is person's body's longest and strongest bone. It is an essential component of the ability to stand and move.

There can be many functions of this bone, some are listed below:

Hold the body weight.Stabilize the body while moving.Connecting hip and knees.

Thus, above mentioned are three functions of femur.

For more details regarding femur, visit:

https://brainly.com/question/3264785

#SPJ2

Two of the many cycles in nature's web of life are the carbon cycle and the A. energy cycle B. water cycle C. food cycle D. heat cycle

Answers

━━━━━━━☆☆━━━━━━━

▹ Answer

B. water cycle

▹ Step-by-Step Explanation

Water is something that is dependent on amongst living things. Without the water cycle, there wouldn't be a source of water and living things wouldn't be able to survive.

Hope this helps!

CloutAnswers ❁

━━━━━━━☆☆━━━━━━━

Cloning to produce embryonic stem cells is called A) regenerative cloning. B) transplantational cloning. C) reproductive cloning. D) therapeutic cloning. E) dedifferentiation.

Answers

Answer:

D

Explanation:

The correct option would be therapeutic cloning.

First and foremost, cloning refers to the process of producing genetically and phenotypically similar organisms or cells from a single organism/cell, be it naturally or artificially. The genotypically and phenotypically similar copies of the original organism are called clones.

Artificial clonings are of different types, namely:

Reproductive cloningGene cloningTherapeutic cloning

Reproductive cloning has to do with producing genetically identical organisms from a particular organism while gene cloning involves producing exact copies of a gene or segments of DNA. Therapeutic cloning, however, involves the production of embryonic stem cells in order to create tissues that would replace similar but damaged or worn-out tissues in living organisms.

Correct option: D

As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: digestion, absorption, motility, secretion, and excretion.

Answers

Answer:

....... motility

Explanation:

In the quest to understand the basis of infertility in humans, researchers have identified a mutation in a gene associated with chiasmata. This protein normally acts to promote homologous recombination.Why might a defect in homologous recombination have consequences for fertility?A. The chiasmata halts the whole process of meiosis, if crossover do not form properly.B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregationC. A checkpoint requires a certain level of genetic variability for meiosis to proceed.D. Chiasmata are the connections between the centromeres and the centromeres that pull them to each pole of the daughter cells.

Answers

Answer:

B. Crossover formation is a necessary step in meiosis I to ensure proper chromosome segregation

Explanation:

Crossing-over is a unique phenomenon that occurs in the prophase I stage of meiosis I, where non-sister chromatids of homologous chromosomes exchange their chromosomal segment. The physical point where this exchange occurs is called CHIASMATA. Hence, a mutation that affects the gene associated with the chiasmata will affect the occurrence of crossing over or homologous recombination.

Crossing-over, through the formation of the chiasmata, is responsible for the physical alignment and proper segregation of chromosomes into gametes. Naturally, the chiasmata formed as a result of recombination during meiosis helps ensure that the chromosomes stay together until it is the right time to separate. This way, any chromosomal defect in the resulting gamete is prevented.

However, an error or defect in homologous recombination might give rise to gametes with chromosomal disorder, a condition known as ANEUPLOIDY i.e. missing or additional chromosomes in gametes. This can affect the fertility of the involved human.

what type of molecule do plant cells use for long term energy storage

Answers

Answer:

ATP

Explanation:

In plants, energy is stored in the form of ATP and NADPH. Energy is produced in the presence of light it is in the thylakoids and mitochondria.

ATP: Adenosine triphosphate

NADPH:  nicotinamide adenine dinucleotide phosphate hydrogen

The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.​

Answers

Answer:

the medical term is hordeolum

Put the vocabulary words in order from largest level of organization to smallest. Reorder answers 1. Population Reorder answers 2. Organism Reorder answers 3. Organ Reorder answers 4. Atom Reorder answers 5. Biosphere Reorder answers 6. Species Reorder answers 7. Organ system Reorder answers 8. Community Reorder answers 9. Cell Reorder answers 10. Ecosystem Reorder answers 11. Organelle Reorder answers 12. Tissue Reorder answers 13. Molecule

Answers

Answer:

The level of organization in order from largest to smallest is;

1. Biosphere

2. Ecosystem

3. Community

4. Population

5. Species

6. Organism

7. Organ system

8. Organ

9. Tissue

10. Cell

11. Organelle

12. Molecule

13. Atom

Explanation:

All living things on Earth are arranged in an hierarchical level of organization. The order in descending way is as follows:

1. Biosphere- Biosphere refers to the part of the Earth that constitutes all living organisms in interaction with their environment. It is the total of all ecosystems on Earth.

2. Ecosystem: Ecosystem refers to a group of living organisms i.e plant, animal and microbes interacting with each other and their abiotic environment e.g water, air etc. An ecosystem comprises of several communities.

3. Community- Community refers to a group of organisms interacting with each other at a particular time and habitat. A community is made up of two or more populations.

4. Population- Population refers to a group of organisms of the same species living together in the same habitat and capable of interbreeding.

5. Species- A species is a group of organisms usually with the same appearance and capable of producing fertile offsprings by interbreeding.

6. Organism- An organism is an individual living thing i.e. plant, animal, microbe. An organism is made up of several organ systems that work together to make it whole.

7. Organ system- Organ system refers to a group of organs working in an interconnected manner to perform certain functions in an organism.

8. Organ- An organ is a structure in an organism that performs a specific function.

9. Tissue- A tissue is a group of cells working together for the same purpose.

10. Cell- A cell is the basic and fundamental unit of life, which is the building block of all living organisms.

11. Organelles- An organelle is a specialized structure in a cell that performs specific functions. e.g. nucleus, mitochondria etc.

12. Molecule- A molecule is the smallest unit of a chemical compound responsible for the chemical identity of that compound. A molecule is made up of two or more atoms chemically bonded together.

13. Atom- An atom is smallest indivisible unit of mattter that partakes in chemical reactions. Atom is considered the smallest unit of matter.

Answer:

:)

Explanation:

DNA and RNA are structurally similar in some ways, but different in others. Identify whether each of the following statements applies to DNA, RNA. both or neither.
1. It can contain the purine adenine.
2. It can contain the pyrimidine uracil.
3. This contains the pyrimidine thymine.
4. In terms of base composition, the %T = %G.
5. This contains the sugar ribose.
6. The sugars are connected with a 3'-5' phosphodiester link.
7. It contains equal amounts of guanine and cytosine.
8. Bases are attached to sugars in an alpha N-glycosides linkage.

Answers

Answer:

DNA

It can contain the purine adenine

This contains the pyrimidine thymine

The sugars are connected with a 3'-5' phosphodiester link.

It contains equal amounts of guanine and cytosine. The percentage of A-T ,C-G are the same in DNA,,they are linked by hydrogen bonds.But varies in RNA.

Explanation:

.RNA

It can contain the purine adenine.

It can contain the pyrimidine uracil

This contains the sugar ribose. This is a 5C sugar with one oxygen atom deficient.The forms the lever for holding the bases and phosphate group

The sugars are connected with a 3'-5' phosphodiester link.This is the backbone of both DNA and RNA.It is formed between the sugars and the phosphate groups in both DNA and RNA.

None is made of  base composition, the %T = %G. This is wrong because purines must pair with pyrimidine,but not two purines or pyrimidine  pairing  as shown,

Bases are attached to sugars in an alpha N-glycosides linkage.This is wrong the beta N-glycisidic bonds are the linkages

Reaching for your coffee cup is accomplished by the _____ subdivision of the peripheral nervous system.

Answers

Answer:

somatic subdivision

Explanation:

The peripheral nervous system is divided into somatic and autonomic systems. The somatic system is required to transport sensory and motor information to the central nervous system. The somatic system is composed of nerves that connect different parts of the body including sensory fibers, skin, and skeletal muscles. On the other hand, the autonomic system can be subsequently classified into sympathetic and parasympathetic systems, which are required in fight (potentially dangerous) and calm-associated responses, respectively.

Prader-Willi syndrome is a genetic disorder involving a partial deletion of chromosome 15q on the paternal chromosome. When both copies of a gene (or chromosome) are functional but only one is expressed, this is an example of ________.

Answers

Answer:

monoallelic gene expression

Explanation:

Monoallelic expression is a type of gene expression where only a copy out of the two copies of a gene is expressed and the other is silent.

A gene is usually represented by two alleles representing alternate forms of the same character. Individuals inherit an allele each from their two parents for every gene within their genomes.

When only one of the alleles is expressed for a particular gene while the other allele remains silent, such phenomenon is referred to as monoallelic gene expression.

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG

Answers

Answer:

a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA

Explanation:

The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20  nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:

Schematically:

The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:

5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'

The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:

3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'

Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska

Answers

Answer:

i think that the answer is B. Hamilton County on the plains of central Texas i took the test

Explanation:

Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.

What are volcanoes?

Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.

Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.

Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.

Learn more about volcano, here:

https://brainly.com/question/18058649

#SPJ5


Which of the following groups gets energy directly from the grass it eats?

Answers

Answer:

herbivores

Explanation:

i think it's herbivores because "herb"ivores get energy when eating grass or any other herb.

Mitotic cell division creates identical copies by replicating a cell's DNA __________ and then dividing ____________.

Answers

Answer:

Mitotic cell division creates identical copies by replicating a cell's DNA once and then dividing once.

Do the spinal nerves include the sensory or motor neurons? Where do these neurons enter or exit the spinal cord?

Answers

Answer:

hd

Explanation:

The spinal nerves include the sensory or motor neurons sensory neuron → brain → motor neuron → muscles.

What are neurons?

Neurons are nerve cells that are specialized to process and transmit information. The brain then processes the information obtained from the sensory neuron and sends another signal trough the motor neuron carrying the message to the muscle.

The spinal cord acts as a nerve center between the brain and the rest of our body and it contains motor neurons that transmits nerve signals from the motor cortex to the body, and the spinal cord also receives all of the sensory information from the periphery of our bodies.

Motor neurons are also known as efferent neurons, they are part of the central nervous system that transmit impulses from the brain or spinal cord to the effector organ (muscles or glands).

Therefore, The spinal nerves include the sensory or motor neurons sensory neuron → brain → motor neuron → muscles.

Learn more about spinal nerves on:

https://brainly.com/question/29803860

#SPJ5

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one on each side. Suppose you lived in southern Arizona where the Saguaro cactus is common and you happen to have one growing in your yard. Your Saguaro has two arms but one is longer than the other. Now, assume that arm length in these cacti are controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths. What is the genotype of your cactus

Answers

Answer:

The genotype is aa. Sorry if I am wrong.

Explanation:

I put the answer in the wrong spot xD

which particles is the fundamental unit of all matter in both living and nonliving

Answers

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

The basal side of epithelium is always connected to?
A) basement membranes
B) connective tissue
C) epithelial cells
D) blood vessels

Answers

Answer:

Basement membranes

Explanation:

Other Questions
A baseball has a mass of 135 grams and a softball has a mass of 270 grams. In which of the following situations would they have the same momentum? The baseball and softball are thrown at the same speed in the same direction. Name a continent on this meridian-15 degrees East a transformer changes 95 v acorss the primary to 875 V acorss the secondary. If the primmary coil has 450 turns how many turns does the seconday have g Nour drove from the Dead Sea up to Amman, and her altitude changed at a constant rate. When she began driving, her altitude was 400400400 meters below sea level. When she arrived in Amman 222 hours later, her altitude was 100010001000 meters above sea level. Let yyy represent Nour's altitude (in meters) relative to sea level after xxx hours. A paint machine dispenses dye into paint cans to create different shades of paint. The amount of dye dispensed into a can is known to have a normal distribution with a mean of 5 milliliters (ml) and a standard deviation of 0.4 ml. Answer the following questions based on this information. Find the dye amount that represents the 9th percentile of the distribution. A microwave oven operates at 2.4 GHz with an intensity inside the oven of 2300 W/m2 . Part A What is the amplitude of the oscillating electric field How did Mehmet II overcome the strategic blocking of the Golden Horn by the Byzantines? what are the possible polynomial expression for dimensions of the cuboid whose volume is 12y2 + 8y -20!!!!!plz answer fast Tyler and Jamie decide to share a box of 50 candy bars. To their pleasant surprise, there are 5 extra candy bars in the box. They agree that Tyler gets at least eight more candy bars than Jamie. What is the minimum number of candy bars that Tyler gets. Can I get a step by step explanation please? Thank you! In answering the question "Which customers are most likely to click on my online ads and purchase my goods?" you are most likely to use which of the following analytic applications?A) customer profitabilityB) propensity to buyC) customer attritionD) channel optimization f(x) = -3x + 7What is f (0)? JOURNEY TO THE CENTRE OF THE EARTH: what did professor get from the havellious bookshop?why he was so much excited. On December 1, 20X1, Tigg Mortgage Co. gave Pod Corp. a $200,000, 12% loan. Pod received proceeds of $194,000 after the deduction of a $6,000 nonrefundable loan origination fee. Principal and interest are due in 60 monthly installments of $4,450, beginning January 1, 20X2. The repayments yield an effective interest rate of 12% at a present value of $200,000 and 13.4% at a present value of $194,000. What amount of accrued interest receivable should Tigg include in its December 31, 20X1, balance sheet Let A and B be any two sets. Show that:Show that (AUB)', (BUA)' = 0 Change 06:00 to 12 hour clock time using a.m. and p.m.I will mark you as brainlist g A slot machine has three slots; each will show a cherry, a lemon, a star, or a bar when spun. The player wins if all three slots show the same three items. a. How many simple events are in the sample space Evaluate the expression. *23 (12 + 6) + 8Please help Bryan decides he wants to help pay for a birthday party for his little brother at the ice rink. It cost $50 to rent the party room and then $4 for each person attending. Bryan only has $100 to spend at the party. a) What are the constraints for this situation? b) Find the domain and range for this situation. Make sure you include all values for each using correct notation. Raj was concentrating so much while working on his project plan that he was late for a meeting. When he went back to his office, he noticed his system was restarted and his project file was not updated. What advice would you provide Raj in this situation? In a zoo there are 6 orang-utans for every 3 baboons. There are 27 orang-utans and baboons altogether. How many are orang-utans?