Pangaea questions, questions in screenshot.

Pangaea Questions, Questions In Screenshot.

Answers

Answer 1

Answer:

While looking at a map of the current Earth, it's continents and land forms can often align, much like a puzzle. This indicates that at one point, Pangea may have been possible. Additionally, the motion of the Earth's tectonic plates supports the thoory of Pangea, as if you were to watch the motion of the Earth's tectonic plates in reverse, you would see that the motion of the pplates would draw land masses closer together.

Explanation:

Expkanation can be found above.

I hope this helps you!


Related Questions

What are two strategies that Bangladesh has used to develop its economy?

Answers

Answer: The latest Bangladesh Development Update: Powering the Economy Efficiently, says that growth will remain resilient, underpinned by strong domestic demand and structural transformation, but there is no room for complacency. To achieve its growth aspirations, Bangladesh needs to create more and better jobs by boosting private investment, diversifying exports and building human capital. The country also needs to make doing business easier, complete its mega-projects on a fast track, improve financial sector governance and ensure a reliable supply of electricity. Further, sustaining its export and remittance growth will be important. It also needs to focus on improving infrastructure, urban management, and environment conservation. and The World Bank was among the first development partners to support Bangladesh following its independence. Since then, the World Bank has committed more than $29 billion in grants and interest-free credits to the country.

Explanation:

What type of tectonic plate boundary to the geographical features

Answers

Answer:

deep sea is convergent

mid ocean is divergent

frequent earthquakes transformational

Explanation:

What does "increase local sustainability" mean?

Answers

Answer:

Local Sustainability means that an area is designed, built and operates in a way that uses energy and natural resources efficiently and equitably, for both present and future generations of humans and other species.

LEVEL 3
Q1
LEVEL 3
Q2
Which of these countries emits the most
carbon dioxide?
Globally, which of the following economic
sectors emits the largest percentage of
greenhouse gas emissions?
A. USA
B. Russia
C.UK
D. China
A. Transportation
B. Electricity and heat production
C. Industry
D. Buildings
LEVEL 3
Q3
LEVEL 3
Q4
Which gas has the highest global warming
potential of all the greenhouse gases?
How much have global average
temperatures increased in the last century?
A. Fluorinated gases
B. Carbon dioxide
C. Nitrous oxide
D. Methane
A. 0.6 degrees Fahrenheit
B. 1.0 degrees Fahrenheit
C. 1.4 degrees Fahrenheit
D. 2.1 degrees Fahrenheit

Answers

Answer:

Q1 china Q2 B. Electricity and heat production

Explanation:

The largest carbon dioxide emitter is China. The majority of greenhouse gas emissions are produced during the production of electricity and heat.

Of all the greenhouse gases, fluorinated gases have the greatest potential to cause global warming. The average global temperature rose 2.1 degrees Fahrenheit during the past century. Options (D), (B), (A), and (D) are thus correct in that order.

What is the greenhouse effect?

The greenhouse effect is a phenomenon in which heat from a planet's host star passes through its atmosphere and warms the surface of the planet, but greenhouse gases in the atmosphere prevent part of the heat from going directly to space, making the world warmer.

Without greenhouse gases, Earth would be below freezing, but the planet's natural greenhouse effect prevents this from happening. Additionally, when greenhouse gas concentrations rise due to human activity, more heat is trapped and the Earth gradually gets warmer.

Hence, chronologically, Options (D), (B), (A), and (D) are correct.

Learn more about the greenhouse effect, from:

brainly.com/question/13706708

#SPJ2

Why do some provinces and territories have a lot of natural resources and others have very little?

Answers

Answer:

The distribution of natural resources depends upon many physical factors like land, climate and altitude. The distribution of resources is unequal because these factors differ from place to place on this earth.

Explanation:

Some provinces and territories have a lot of natural resources and others have very little because Many physical elements, such as land, temperature, and altitude, influence the distribution of natural resources.

Why is there a lack of natural resources?

Natural resource depletion happens when resources are depleted faster than they are replaced. Natural resources are those that exist in the absence of human intervention and can be renewable or non-renewable.

Based on their geographic position and historical geologic processes, various areas have access to diverse renewable or nonrenewable natural resources such as freshwater, fossil fuels, rich soil, or timber.

Many physical elements, such as land, temperature, and altitude, influence the distribution of natural resources. Because these characteristics change from location to place on this planet, the distribution of resources is uneven.

Learn more about natural resources here:

https://brainly.com/question/13954163

#SPJ2

This globe from the atmospheric moisture investigation shows specific humidity, with blue and green being highest. What is a possible explanation for why specific humidity values are relatively low in the ocean adjacent to the western coast of southern Africa

Answers

Answer:

Due to temperature.

Explanation:

The values of specific humidity are relatively low in the ocean adjacent to the western coast of southern Africa because of the presence of temperature of large water bodies around the area. Humidity depends on the temperature of the air means if the temperature is higher than there is high humidity in the air because the air has the ability to hold more water vapors which ultimately increases humidity.

Which of the map
projections accurately
preserves size of areas?
A) Mercator
B) Eckert

Answers

Answer: I think it is B) Eckert.

Explanation:

Mercator distorts the size of continents, making russia and greenland look huge and africa look small. That means it must be Eckert.

A logical argument that is presented in graphical from using boxes and arrows is called a ?

Answers

Answer: flowchart proof

Explanation:

A logical argument that is presented in graphical from using boxes and arrows is referred to as the flowchart proof.

The flowchart proof is referred to as the logical argument that is presented in a flowchart form. If shows the arrows from the information to the conclusion which is being demonstrated and the logical reasons that supports the statement are given below the box.

To what does the term Holocaust refer?
A-Nazi invasion of eastern Europe
B-Nazi invasion of Poland
C-concentration camps located at Auschwitz
D-the Nazi killing of 6 million European Jews during WWII

Answers

D) the Nazi killing of 6 million European Jews during WWll

Hope this helps ;)
D) the Nazi killing off 6 million European Jews during WWII

which of the following is characteristic of both weathering and erosion?

Answers

If there are multiple choice answers then put them in the comments I’ll answer it but if there aren’t then I would say they both break down the rock

In the diagram to the left ADE is an isosceles triangle. Segment EC bisects DCB.

A. Find the measures of DAE, ECB, and EBC
B. Explain how you were able to find the measures of these three angles

Answers

Answer:

m<DAE = 35°

m<ECB = 37°

m<EBC = 71°

Explanation:

✔️Find m<DAE

∆ADE is said to be an isosceles triangle, therefore, the base angles, <DAE and <AED are of equal measures.

Thus, m<ADE is given as 110°. Therefore,

m<DAE = ½(180 - m<ADE)

Substitute

m<DAE = ½(180 - 110)

m<DAE = ½(70)

m<DAE = 35°

✔️Find m<ECB:

We are told that segment EC bisects <DCB. This implies that <DCB is divided into two equal angles, which are <ECD and <ECB.

This means that:

m<ECD = m<ECB

Since m<ECD is given as 37°, therefore:

m<ECD = m<ECB = 37°

m<ECB = 37°

✔️Find m<EBC:

m<EBC = 180 - (m<CAB + m<ACB)

m<CAB = m<DAE = 35°

m<ACB = 2(m<ECD) = 2(37) = 74°

Plug in the values

m<EBC = 180 - (35 + 74)

m<EBC = 180 - 109

m<EBC = 71°

1.A good indicator of earthquake is:
a dry or warm weather
b. low tide
c. noisy animals
d. none of the above. We cannot predict earthquake​

Answers

d. None of the above. We cannot predict earthquake
d. None of the above

Explain the importance of learning about
population.​

Answers

it makes u know more about the society

Explanation:

this might help you out with the question..

22. Find the value of x. Round your answer to the nearest tenth.
20°
9
Not drawn to scale
Geometry

Answers

Answer:

[tex]x = 24.7[/tex]

Explanation:

Given

See attachment

Required

Find x

To find x, we make use of tangent formula

[tex]\tan(20) = 9/x[/tex]

Cross multiply

[tex]x * \tan(20) = 9[/tex]

Make x the subject

[tex]x = 9/\tan(20)[/tex]

[tex]x = 9/0.3640[/tex]

[tex]x = 24.7[/tex] --- approximated

An emerging market is an economy that is in transition to becoming a stronger market.

True or False

The Correct answer is True

Answers

Answer:

True then

Explanation:

You just gave yourself the correct answer. It is, indeed, true!

Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? *

a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O

a decrease in the amount of insolation reaching Earth's surface

an increase in the amount of greenhouse gases in Earth's atmosphere

an increase in the amount of vegetative cover in the tropics​

Answers

Answer:

20 km away from mid Atlantic ridge. Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? An increase in the amount of greenhouse gases in earths atmosphere.Explanation:

what is the range of rhe following set if numbers? a 22 b 44 c 66 d 88​

Answers

Answer:

66

Explanation:

its 66 because the highest number is 88 and the lowest is 22 and the difference is 66


What are the factors and/or processes of piracy that cause the global pattern of the daimond industry

Answers

Answer:

The factors and/or processes are listed below

Explanation:

The factors and/or processes of piracy that cause the global pattern of the diamond industry are;

- The production development of synthetic diamonds made from subjection of graphite to very high temperatures and pressures.

- The production of stimulants of diamonds which is basically not real diamonds but posses some of the features of the real diamond.

Global changes and problems such as population growth, deforestation, chemical spills, air pollution, burning natural gas, coal and oil, pesticides, industrial gases, carbon dioxide, emissions contribute to global warming which results in

Answers

Answer:

If the choices are as follows...

A.Extreme Weather Events

B.Shortage of potable water around the World

C.More frequent heat waves and droughts

D.All of the above

Explanation:

Then It should be D.

Global changes and problems such as population growth, deforestation,  air pollution, burning natural gas, coal and oil, pesticides, industrial gases, carbon dioxide, and emissions contribute to global warming which results in a disbalance in the natural ecosystem and an increase in temperature.

What is deforestation?

Deforestation is referred to as the cutting down of trees in large numbers which reduced the quantity of plant vegetation in order to perform commercial activities with the objective to develop better infrastructure.

If the number of greenhouse gases in the atmosphere suddenly increased, more heat would be radiated toward the surface of Earth, causing a dramatic rise in temperature.

Global issues and adjustments like deforestation, air pollution, burning of fossil fuels like coal, oil, and gas, pesticides, industrial gases, and emissions all contribute to global warming, which disrupts the natural ecosystem and makes it harder for organisms to survive.

Learn more about the increase in temperature, here:

brainly.com/question/12908180

#SPJ5

The complete question is probably

Global changes and problems such as population growth, deforestation, chemical spills, air pollution, burning natural gas, coal and oil, pesticides, industrial gases, carbon dioxide, emissions contribute to global warming which results in __________________________

On a cool summer morning in East Lansing, Michigan, the temperature was 7 ℃elsius and the air was saturated with​ RH​ = 100%. That afternoon, the temperature rose to 29° Celsius. If the same air mass remained in place all day (meaning the moisture content did not change throughout the day).

Required:
a. Would the relative humidity increase or decrease in the afternoon?
b. What was the relative humidity during that afternoon (rounded to the nearest percent)?

Answers

Answer:

The correct answer is -

a) The relative humidity decreases with an increase in temperature.

b) 25%

Explanation:

The dew point (Td) is the temperature at which the Relative humidity (RH) is 100%. So in the given question dew point, is (Td) is 7° C. The RH can be calculated by the formula:

[tex]RH: =100*\frac{(EXP((17.625*TD)/(243.04+TD))}{EXP((17.625*T)/(243.04+T)))}[/tex]

Putting the values of Td and T we get RH=

[tex]RH: =100*\frac{(EXP((17.625*7)/(243.04+7))}{EXP((17.625*29)/(243.04+29)))}[/tex]

= 25.02 or 25 %.

What force causes the shape of streams and rivers in a watershed?

A. Nuclear force
B. Electromagnetic force
C. Gravity
D. Buoyancy

Answers

Answer:

gravity

Explanation:

streams erode dirt and rocks, transport the sediment, and redeposit it in new locations shaping the earths surface into a system of stream valleys. streams now flow downhill due to the force of gravity

That would be C, gravity.

Gravity moves many things, right now we have gravity pushing us down! Gravity can move things, so that would make the most sense.

Overall, sedimentary rocks comprising most of the oceanic crust tend to be much older than plateaus of rocks found far away from volcanic activity in the center of continents.
A. True
B. False

Answers

Answer:

A. True

Explanation:

Oceanic crust, while older than plateaus of rocks found far away from volcanic activity, it is much thinner, denser, younger, and of different chemical composition than continental crust. Continental crust is typically 30-50 km thick, whilst oceanic crust is only 5-10 km thick.  On the other hand, plateaus of rocks are formed from volcanic activities and are of more recent occurrence than oceanic crust.

Find the midpoint of the segment with the following endpoints.
(10,6) and (4,9)

Answers

Answer:

The coordinates of the midpoint are [tex]M(x,y) = \left(7, \frac{15}{2} \right)[/tex], respectively.

Explanation:

Given two distinct points ([tex]A(x,y)[/tex], [tex]B(x,y)[/tex]), the midpoint of the segment ([tex]M(x,y)[/tex]) is determined by the following expression:

[tex]M(x,y) = \frac{1}{2}\cdot A(x,y) + \frac{1}{2}\cdot B(x,y)[/tex] (1)

If we know that [tex]A(x,y) = (10, 6)[/tex] and [tex]B(x,y) = (4,9)[/tex], then the coordinates of the midpoint are:

[tex]M(x,y) = \frac{1}{2}\cdot (10, 6) + \frac{1}{2}\cdot (4,9)[/tex]

[tex]M(x,y) = (5,3) + \left(2,\frac{9}{2} \right)[/tex]

[tex]M(x,y) = \left(7, \frac{15}{2} \right)[/tex]

The coordinates of the midpoint are [tex]M(x,y) = \left(7, \frac{15}{2} \right)[/tex], respectively.

Temperature and precipitation are characteristics of:
a. longitude
b. climate
c. vegetation
d. latitude

Answers

Answer:

B

Explanation:

longitude has nothing to do with this, vegitation is with plants, and latide just like longitude has nothing to do with it.

South Africa's population grew by 17,5% in a period of 10years to reach a total of 52million in 2011.what is the double time for South africa?​

Answers

Answer:

The estimated population of South Africa stands at 58,78 million, according to the recently released 2019 mid-year population estimates (MYPE). The MYPE report provides population estimates at national and provincial levels, disaggregated by age and sex.

World Population Day, which took place on the 11th July, focused on enabling the youth with the necessary skills to reach their potential and economic growth. According to the mid-year estimates of 2019, the youth (aged 18–34) constitute almost a third of the population (17,84 million) in South Africa, with 9,04 million males and 8,80 million females. Almost 30% of youth (5,10 million or 28,6%) reside in Gauteng, with 3,47 million in KwaZulu-Natal (19,4%), making up almost half of all youth in South Africa. The Free State (4,7%) and the Northern Cape (2,0%) have the lowest proportions of youth

PLEASE HELP THIS IS DUE NOW
will mark brainliest!
10 points

Answers

i think so option d is correct

SOME COUNTRIES HAVE A LARGE AMOUNT OF COPPER AND SOME HAVE NO COPPER

Answer:

D. Some countries have a large amount of copper, and some have no

copper

Clearly the map shows some countries are left out.

also, interisting observation i just made is it seems as though copper is found mostly by the coast.

GOOD LUCK!

PLEASE HELP THIS IS DUE NOW
will mark brainliest!
10 points

Answers

Answer:

C

Explanation:

Earth's tilted axis causes the seasons. Throughout the year, different parts of Earth receive the Sun's most direct rays. So, when the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. And when the South Pole tilts toward the Sun, it's winter in the Northern Hemisphere.

C -it’s the most reasonable choice from all the rest

With respect to the earth as a system, the lithosphere is concerned with
air
water
(1)
(2)
(3)
(4)
vegetation
rocks​

Answers

Answer:

d) rocks

Explanation:

lithosphere is the crust or ground surface

hydrosphere is all the water bodies

atmosphere is involve the air

With respect to the earth as a system, the lithosphere is concerned with rocks.

Hence, the correct answer is option d.

The lithosphere is the rigid, outermost layer of the Earth, encompassing the crust and uppermost part of the mantle. It constitutes the solid Earth's outer shell and is broken into large and small tectonic plates that float on the semi-fluid asthenosphere beneath.

The lithosphere's thickness varies, ranging from about 5 to 100 kilometers. This layer is crucial to Earth's geology and plate tectonics, as it hosts various geological processes, including volcanic activity, earthquakes, and mountain-building. It plays a vital role in shaping the Earth's surface and influencing the distribution of landmasses and ocean basins.

Know more about plate tectonics here:

https://brainly.com/question/29775061

#SPJ2

The given question is not properly written. Hence, the proper question is:

With respect to the earth as a system, the lithosphere is concerned with

a. air

b. water

c. vegetation

d. rocks​

how to raise awareness of water pollution around your school?

Answers

Answer:

Try to avoid using too many plastics.  

Plastic waste is not only damaging to the water when broken down, but due to the harm done to marine life, it can also spread death and decay in the water.

Reuse things where possible. ...

Try to opt for recyclable and reusable options.

Explanation:

Have a nice day

In the 1990s, ethnic diversity as a divisive force best described conditions in which country?
a. Brazil
b. Japan
c. Switzerland
d. Yugoslavia

Answers

Answer:

Hello There!!

Explanation:

I believe the answer is D. Yugoslavia.

hope this helps,have a great day!!

~Pinky~

Other Questions
A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? can someone please explain how to complete this thanks A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N