PLEASE ANSWER QUICK!The Greek roots of the word prokaryote mean “before nucleus.” Describe the way that DNA is organized in prokaryotic cells without the help of a nucleus. How does this approach differ from the way that eukaryotic cells organizes their DNA

Answers

Answer 1

Answer:

Prokaryotic cells' DNA are located in the cytoplasm of the cell rather than in the nucleus, like in eukaryotic cells. DNA aids in protein synthesis and determines functions of the cell in cells, regardless of being within the membrane of a nucleus or not.

-----

I hope this helps a little.

Answer 2

The word prokaryote in Greek means before kernel (nucleus). Unlike the eukaryotic cells, the nuclear material is located in the cytoplasm of the cell in a nucleoid.

What are the characteristics of prokaryotic cells?

The prokaryotic cells are the primitive karyons that are defined by the lack of the true nucleus and organelles. Unlike the eukaryotes, the organelles lack the membrane that covers them but has a tough cell wall.

The prokaryotes include archaea and bacteria which are unicellular and microscopic organisms that are simple and have their genetic material organized into nucleoids in the center of the cell. They have the ability to live in harsh conditions.

Therefore, the eukaryotes and prokaryotes differ in the arrangement of the genetic material.

Learn more about prokaryotes, here:

https://brainly.com/question/18348786

#SPJ2


Related Questions

identify a probable reason that the dark moths survived while the light moths did not during the industrial revolution

Answers

Answer:

directional selection

Explanation:

The directional selection is a type of Darwinian selection where a particular phenotype is favored in the population, thereby modifying the allelic frequencies to increase the proportion of the favored phenotype. Biston betularia, also known as peppered moth, is a species that was influenced by directional selection in its recent past. Before the industrial revolution, the frequency of light-colored moths was predominant compared to the darker-colored phenotypes, because this color has higher adaptive fitness in a clean, no pollution environment, thereby light-colored moths were able to avoid predatory birds. However, during the industrial revolution, the frequency of dark-colored moths increased in response to pollution (i.e. darker environment), thereby conferring a higher adaptive fitness to darker phenotypes.

Answer:

Dark wings

Explanation:

TIME PEM
01:57
The majority of early psychological research reflected the
A differences among males and females
В. concerns and interests of minorities
C. differences among various cultures
concerns and interests of white males​

Answers

The answer to this is D

Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.

Answers

Answer:

The two strands of DNA are replicated in different ways

Explanation:

DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).

g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Answers

Answer:

The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Explanation:

Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.

ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.

Answers

Answer:

B.

Explanation:

Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.

ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.

Hence, the correct option is "B".

Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)

Answers

Answer:

The correct answer is C. All light tan        

Explanation:

You will find the answer and explanation in the attached file due to technical problems.

HELPPPPP Which of the following pieces of evidence supports that species change due to certain genetic variations? Darwin's theory of evolution was incorrect, as it did not account for variation in a species. Natural selection causes variation but cannot cause the evolution of a new species. Mutation and natural selection both cause changes in a population. Changes in a population abruptly occur as a direct response to the environment.

Answers

Answer:

D. Mutation and natural selection both cause changes in a population

Explanation:

I just took the test. Good luck! :)

The two evidences that supports the fact that species change due to certain genetic variations are that mutation and natural selection both cause changes in a population.

What is natural selection?

Natural selection is the postulation by Charles Darwin that organisms that are more adapted to their environment live longer and reproduce hence pass on their favorable traits to their offspring.

The two evidences that supports the fact that species change due to certain genetic variations are that mutation and natural selection both cause changes in a population.

Learn more about natural selection: https://brainly.com/question/1657375

The shape of the path of a planet or asteroid around the sun is an

Answers

Answer: Elliptical (similar to an oval shape)

Explanation: planets and asteroids in orbit around the sun move in a path shaped like an elliptical

Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.​

Answers

Answer:

A

Explanation:

Took test on Edge.

Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.

What is MSDS?

Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.

Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.

Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.

Learn more about MSDS here:

https://brainly.com/question/3282390

#SPJ6

The Middle Latitudes have:

Answers

Answer:

The Middle Latitudes have cyclones and anticyclones

Explanation:

The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.

The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.

If a cusp is lost during preparation, which matrix band would provide the best support while restoring

Answers

Answer:

I would use a specialized or preformed matrix for the posterior sector.

Explanation:

Losing a cusp is a much more critical situation, that is, there will be less tooth remnant and less resistance to functional and parafunctional forces.

The matrices that are usually used in the posterior sector are matrices that must be burnished and already come with a format to better restore the functional unit of the occlusal surface.

It is important to clarify that cusps are only in the posterior sector and not in the anterior sector.

The cusps, even if they have the most correct selection of the matrix, will fail in their restoration if they are not performed according to the patient's occlusion, under a good dental integration system such as adhesion through resins, and respecting the normal antomy of the piece to be restored.

Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?

Answers

Answer:

Due to optimum environment for microbes.

Explanation:

I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.

You are observing a sample of cells in the lab to determine why they did not
divide properly. You notice that the chromosomes are lined up in the middle
of the cell, and the spindle fibers have extended towards them, but have not
attached. What could be damaged?

Answers

The kinetochore of the chromosomes


Explanation:
What could be damaged that is hindering the spindle fibers from attaching to the chromosomes are the kinetochores of the chromosomes.
At the metaphase stage of the cell division, the chromosomes align at the equator of the cell and the spindle fibers engage each chromosome at a region known as the kinetochore.
The kinetochore is made up of complex proteins and lies around the centromere region of the chromosome. The microtubules of the spindle fibers attach to this region during the metaphase stage.
If the kinetochore is damaged, it means the spindle fiber will not be able to attach to the chromosome.

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.

Answers

Answer:

The correct answer is - option B. They are small because they lack a nucleus.

Explanation:

Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.

In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.

Thus, the correct answer is : option B. They are small because they lack a nucleus.

Which sequence shows a subsitutuon mutation

Answers

Answer: Actually the answer is D. It is supposed to be identical to the original, that is why it can be a substitute.

Explanation: I just took the test, this is 100% correct.

Brainliest please?

The sequence that shows substitution mutation is the sequence in option D.

What are the nucleotide bases?

The DNA sequence is the sequence or pairing of DNA bases. RNA and DNA both are genetic materials and both are made up of nucleic acids made up of deoxyribose acid and iron is made up of ribonucleic acid.

DNA and RNA both contain four bases that are joined with hydrogen bond RNA contain uracil in the place of thymine and DNA contain timing all other bases are the same.

The base pairs are complementary to each other: Thymine: Adenine and cytosine: guanine. But in RNA, it is uracil with adenine. Guanine and cytosine are the same. So the adjacent base pairs will be adenine and uracil.

Therefore, the correct option is a sequence in option D.

To learn more about substitution mutation, refer to the link:

https://brainly.com/question/26486518

#SPJ2

The anticodon (Select all that apply):

a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds

Answers

Answer:

choice A

Explanation:

An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.

Formula, name, and Group number of element needed for:     (i) hypothyroidism -     (ii) hypertension     (iii) kidneys     (iv) bones

Answers

Answer:

I) Hypothyroidism involves the insufficient production of thyroid in the thyroid gland which helps in the development of individuals. The element Iodine enhances the production of the thyroid.

I2- Iodine - Group number 17

Hypertension - Too much Salt which contains sodium in foods causes hypertension.

Na- Sodium- Group number 1

Bones require Calcium for its proper development and also helps to strengthen it.

Calcium - Ca- Group number 2

Kidney - Excess sodium in kidneys could result to kidney diseases which is why plenty of water should be taken to help the kidney from this element.

Na- Sodium- Group number 1

Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.


Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change

TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)

Answers

Answer:

During intense exercise:

lung capacity increases

vital capacity increases

respiratory capacity increases

functional residual capacity increases

tidal volume increases

the inspiratory and expiratory reserve volumes decrease as does the residual volume.

Explanation:

Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.

If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.

Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.

It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage

Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome

Answers

Answer:

The correct answer is B

Explanation:

Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.

A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.

Many inherited human diseases such as cancer are related to Alu insertions.

Cheers!

Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria

Answers

Answer:

DNA

Explanation:

cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.

Answer:

A- DNA

Explanation:

Provide one example of quantitative data that can be collected when using a microscope?

Answers

Answer: there 3 ducks by the pond

Explanation:

Quantitative is numbers. how many.

In humans, a type of blindness is due to a dominant allele (B). Normal vision is the result of a
recessive allele (b). Migraine headaches are due to a dominant allele (M), and normal (no migraines)
is recessive (m).
A male who is heterozygous for blindness and does not suffer from migraines marries a woman who
has normal vision and does not suffer from migraines.
Could they produce a child with normal vision who does not suffer from headaches? If yes, can the
probability of such a child be determined?
You must draw a Punnett square within the space provided to receive any credit for your answer!

Answers

Answer:

Yes, a child with normal vision who does not suffer from headaches can be produced.

The probability of producing such child from this cross is 1/2 or 50%

Explanation:

This question involves two distinct genes in humans. One coding for blindness and the other for Migraine headaches. The alleles for blindness (B) and Migraine (M) are dominant over the alleles for normal vision (b) and no Migraine (m).

According to the question, a male who is heterozygous for blindness and does not suffer from migraines will have the genotype; Bbmm while a female who

has normal vision and does not suffer from migraines will have genotype; bbmm. If these two parents are crossed, the following genotypes of gametes will be produced by each parent:

Bbmm- Bm, Bm, bm and bm

bbmm- bm, bm, bm, and bm

Using these gametes to construct a punnet square (see attached image), the following offsprings with genotypes; Bbmm and bbmm in the ratio 1:1 will be produced.

Bbmm (8/16) are offsprings with blindness and have no Migraine headache

bbmm (8/16) are offsprings with normal vision and have no migraine headache

Hence, this cross can produce a child with normal vision who does not suffer from headaches (bbmm). Also, the probability of producing such child is 8/16 or 1/2.

How does your body know when cells are missing

Answers

Answer:

Receptors provide information to nervous system about missing cells.

Explanation:

Your body know when cells are missing due to nervous system. The network of nervous system spreads throughout human body which provide information about what is going on in the body. If the cells are missing due to injury, the nervous system gives instruction to the body to produce more cells and transported that cells to the region where these cell are required. So receptors are responsible to provide information to nervous system about missing cells.

The body knows cells are missing as a result of the receptors sending

to the central nervous system.

The human body consists of cells which have neurons. These neurons are

responsible for the passage of messages and information to other parts of

the body.

When a cell is missing from the body, signals are passed to the central

nervous system which consists of the brain and spinal cord and they then

relay impulses which helps to fix the issue so as to ensure optimal

functioning of the body.

Read more on https://brainly.com/question/17150388

Foodborne illness outbreaks can be caused by microorganisms such as bacteria, viruses, or parasites. Determine whether each outbreak was caused by bacteria, viruses, or parasites.

a. A foodservice worker who doesn't wash his hands after handling contaminated seafood causes highly contagious tulike symptoms for passengers on a cruise ship
b. Raw oysters contaminated with Vibrio vulnicus.
c. An infected foodservice handler touches raw vegetables for a salad and transfers the condition that causes jaundice and liver damage to the customer who ordered the salad
d. A broken water main in a port town contaminates a boat's entre water supply with Cryptosporidium.
e. Prepackaged lettuce contaminated with Salmonella.
f. A broken meat thermometer ends up causing dinner guests to eat an undercooked pork roast infected with Thichinella spiralis.

Answers

Answer:

a. Undefined  

b. Bacteria

c. Viruses

d. Parasite

e. Bacteria

f. Parasite

Explanation:

In the first case is imperative to obtain more information in order to determine the causes of this contagious disease (contaminated seafood may be associated with different types of infections).

Vibrio vulnificus is a Gram-negative pathogenic bacterium associated with the consumption of contaminated oysters. V. vulnificus causes gastroenteritis, necrotizing infections and invasive sepsis.  

Jaundice is a condition caused by hepatitis A, B and E viruses, it is a disease associated with poor liver function and the destruction of red blood cells.  

Cryptosporidium parvum is a protist parasite (Phylum Apicomplexa) that causes the diarrheal disease cryptosporidiosis. C. parvum parasite is present in contaminated foods and water.

Salmonella enterica is a Gram-negative bacterium transmitted by eating contaminated foods, which causes severe diarrhea, fever and abdominal pain. Salmonella infection may also cause inflammatory diseases and dehydration.

Thichinella spiralis is a parasitic nematode that causes the trichinosis, a disease where larvae migrate to muscle, thereby producing muscle pains and serious pathologies. Trichinosis is caused by eating undercooked meat from contaminated animals.

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?A) How does carbon dioxide get into these protists with their glasslike valves?B) How do diatoms get transported from one location on the water's surface layers to another location on the surface?C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?D) How do diatoms with their glasslike valves avoid being shattered by the action of waves?E) How do diatom sperm cells locate diatom egg cells?

Answers

Answer:

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?

C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?

Explanation:

Diatoms are some of the most important organisms living on earth because of its role on the oxygen production in the planet earth. The question "how do diatoms with their glasslike valves keep from sinking into poorly lit waters?" Because of the way their nutrition is obtained from functional chloroplasts and the way them encased within two porous, glasslike valves.

Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices

Answers

Answer:

The correct answer is "Aquaporin".

Explanation:

The missing options of this question are:

A. ATP synthetase

B. Aquaporin

C. The sodium-potassium pump

D. Integrin

The correct answer is option B. "Aquaporin".

Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.

Which macromolecule forms a double layer as the primary structure of cell membranes?
fats
oils
phospholipids
steroids​

Answers

Answer:

phospholipids

Explanation:

Answer:

C. phospholipids

Explanation:

The other person said it

Which describes the geological time of the first land plants? Conifers appeared after the first flowering plants. Conifers first appeared around 182 million years ago. The first flowering plants appeared around 240 million years ago. The first flowering plants were introduced toward the end of the Mesozoic era.

Answers

Answer:4-)The first flowering plants were introduced toward the end of the Mesozoic era.Explanation:PLZS MARK BRAINLIEST PLZS PLZSI NEED THREE MORE TO LEVEL UP PLZS PLZS I NEED THREE SO PLZS MARK BRAINLIEST

The geological time of the first land plants were introduced toward the end of the Mesozoic era.

What is Mesozoic era?

This era is referred to as the age of Conifers and it lasted from about 252 to 66 million years ago.

In this era, there was the presence of most ancestors of plants and animals which is why it being a period where first land plants were introduced is appropriate.

Read more about Mesozoic era here https://brainly.com/question/4824228

whats the answer guys help me out

Answers

Answer:

Read Exp:

Explanation:

1st one - Attracts Pollinators.

2nd one -  Prevents water loss.

3rd one - Traps insects.

Other Questions
F19) The points (6,5), (7,2), (9,6), and (10,3) are vertices of an inscribed square.A)(x - 8)2-(y - 4)2 = 5B) (x 8)2 + (y - 4)2 = 15C) (X + 8)2 + (y + 4)2 = 5D) (x - 8)2 + (y - 4)2 = 5Find an equation for the circle What aspects of psychodynamic theory do you think still have relevance in todays world? Was there one neo-Freudian whose theory appealed to you, and if so, why? James hires Franco for a painting job. Their contract explicitly states that Franco's employment can be terminated if he is employed by another party during the contract period. Two weeks into the job, James finds out that Franco is also working for a painting agency two blocks away and terminates his employment. This is an instance of ________. based on the characteristics of constructive conflicts, which of the following would help a manager create constructive conflicts during a debate? 1. Support the weaker members during a debate 2. Explain conflict in terms of interpersonal incompatabilities 3. Support the stronger memebrs during the debate 4. Keep the debate focused on the issue 5. Maintain competitive oreientation on the debate What is the value of "c" in the quadratic equation 3x^2 + 5x + 7 = 0? Ramesh or Harish______won the prize. ( verb has/ have) whats the topic of A Psalm of Life Which of the following body reactions is characteristic of the stress response? Pupils constrict Blood pressure increases Body temperature drops Heart rate decreases Bobby's father has been prescribed an oral hypoglycemic drug. Such drugs act: 1. To reduce insulin resistance 2. To decrease the body's need for glucose in body cells 3. To prevent the formation of glucose 4. As an insulin replacement" What does the word controlled mean as it is used below?The puppets are controlled with guiding sticks. These sticks push the puppets around to music.massagedoperatedinspiredassumed michelle works in retail and cant decide what products to include i the stores front window display what is the first step she should take to solve this problem If the data rate is 10 Mbps and the token is 64 bytes long (the 10-Mbps Ethernet minimum packet size), what is the average wait to receive the token on an idle network with 40 stations? (The average number of stations the token must pass through is 40/2 = 20.) Ignore the propagation delay and the gap Ethernet requires between packets. what does (where's the fire )mean? HELPP! QUICKKKK! Lol Problem:Last year I attended the Jurassic World Dinosaur Exhibit with my family and my friend and her family. Myfamily includes 2 adults (including myself) and my child we paid a total of $94. Her family includes 2adults and 2 children she paid a total of $110. What was the admission price for an adult ticket and howmuch was it for the admission price for a child ticket?Let a represent adult ticket priceLet c represent child ticket price A group of 6 people planned to spend $10.00 each torent a boat for an outing. At the last minute, 1 personcould not go on the outing. The others then paidequally for the boat. How much did each pay? Which option describes meeting deadlines, teamwork, and leadership? A. career cluster B. career pathway C. job specification D. technical skills E. transferable skills What profit-oriented pricing method is often used because of the difficulty in establishing a benchmark of sales or investment to show how much of a firm's effort is needed to achieve the target Write the equation of a circle with a center at (12, 6) and a radius of 6. #4: Directions: Read the paragraph and answer the question. (1) This morning I had more problems than I could solve. (2) First, my shoelace broke and I had to tie my running shoes with string. (3) Next, my dog jumped up on my chair and bumped my arm which caused me to spill orange juice all over my shirt. (4) Finally, I missed the bus and had to walk to work through the rain. Select the correct answer. Which numbered sentence is the topic sentence? A. 1 B. 2 C. 3 D. 4 E. 5 In Exercises 22 describe how the change affectsthe surface area of the right prism or right cylinder. Thank you!!