Please help ASAP!! 20 points givin

Please Help ASAP!! 20 Points Givin

Answers

Answer 1

Answer:

d or b

Step-by-step explanation:

quick math

Answer 2
Answer is A 5/3
Hope it helps :)

Related Questions

1-i need to mix 25% mineral spirits to the varnish i am using what ratio of spirit to varnish am i using? 2-if i use 240 ml of varnish what quantity of mineral spirits will i need in ml ? 3-Robison's tapestries all measure 1.5m x 1m wide. Express the proportion of the tapestries' heights to width using whole numbers. Give the answer in ration.

Answers

Answer:

(1) The required ratio of spirit to varnish is 1:3.

(2) You need 80 ml of mineral spirit.

(3) The ratio of tapestries' heights to width is 3:2.

Step-by-step explanation:

(1) If you need to mix 25% mineral spirit to the varnish, then the solution would contain 25% mineral spirit and 75% varnish.

So, [tex]\frac{spirit}{varnish}=\frac{25}{75}[/tex]

                  [tex]=\frac{1}{3}[/tex]

Thus, The required ratio of spirit to varnish is 1:3.

(2) If you use 240ml of varnish, then this quantity is 75% of the total solution or ration of varnish to the total solution will be 3:4.

Let [tex]x[/tex] be the quantity of total solution.

Then, [tex]240:x=3:4[/tex].

⇒[tex]\frac{240}{x}=\frac{3}{4}[/tex]

⇒[tex]3x=240*4[/tex]

⇒[tex]x=\frac{240*4}{3}[/tex]

⇒[tex]x=320[/tex]

That is, total solution is 320 ml.

Now, Spirit = Total solution - Varnish

⇒Spirit = 320ml-240ml

⇒Spirit = 80ml

Hence, if you use 240 ml of varnish, you need 80 ml of mineral spirit.

(3) Robison's tapestries all measure 1.5m long and 1m wide. First, we express dimensions in whole numbers by multiplying them by 10.

Then, dimensions are 15m long and 10m wide.

Now, Height : Width = 15:10

⇒[tex]\frac{Height}{Width} =\frac{15}{10}[/tex]

⇒[tex]\frac{Height}{Width} =\frac{3}{2}[/tex]

Hence, the ratio of tapestries' heights to width is 3:2.

please solve question in picture branoist to first and correct​

Answers

Answer:

The correct answer is Option 3: 12y

Step-by-step explanation:

A polynomial term is usually made of a variable and a co-efficient.

Like terms are those terms that have the same variables i.e. x and 44x are like terms.

Given expression is:

[tex]6y-2y+8y[/tex]

All the terms have only y which means that all three terms are alike.

The coefficients of like terms are added or subtracted according to their sign.

[tex]6y-2y+8y[/tex] = 12y

Hence,

The correct answer is Option 3: 12y

the food pantry distribution 10 oz bags of rice if 3 5 lb bags are donated to the pantry how many 10 ounce bags can be made ​

Answers

Answer:

24 bags can be made from three 5 pounds bags.

Step-by-step explanation:

Given that:

Three 5 pound bags are donated.

Total weight of bags = 3*5 = 15 pounds

We know that:

1 pound = 16 ounces

15 pounds = 16*15 = 240 ounces

A bag weighs 10 ounces.

Number of bags = [tex]\frac{240}{10}[/tex]

Number of bags = 24 bags

Hence,

24 bags can be made from three 5 pounds bags.

Fill in the table to show a proportional relationship and then identify the constant of proportionality for the cost to the number of yoga classes. In the answer box, please list the constant of proportionality

Answers

Answer:

30 = 2

60 = 4

90 = 6

120 = 8

Step-by-step explanation:

60/4 = 15

15 = 1

30 = 2

45 = 3

60 = 4

75 = 5

90 = 6

105 = 7

120 = 8

418/36 as a mixed number

HELP PLEASE

Answers

Answer:

11 11/18

Step-by-step explanation: a quick search

The feet of a poem can easily be compared to _______.

a heartbeat
footsteps
a musical beat
a drum beat

Answers

A footsteps I believe

Answer:

its a heartbeat.

Step-by-step explanation:

sorry for late answer, just answering for any future people.

Look at at pic attached! Pls hurry :( 21 points

Answers

Answer:

C option

Step-by-step explanation:

bcz root of 121 is 11. then 2/3 +11 will give you a rational number.

Answer:

2/7 + square root of 121 (the third one)

Step-by-step explanation:

a rational number is a number where if you write it as a fraction, both the numerator and denominator are integers (numbers like 1 and 2 but not like 3.4 or 5.6)

the equation simplified a bit looks like this:

2/7 + 11/1

anddd so all the numbers are integers which means that expression is correct :3

I need help on this with solutions please

Answers

Answer:

See answers below:

1. AAS2. ASA3. SAS4. HL5. SSS6. ΔABC ≅ ΔDFE7. ΔTRS ≅ ΔTUV8. ΔTRS ≅ ΔSUT9. ΔCAB ≅ ΔFDE

Multiply the polynomials: (x – 4)(x2 + 2x – 5)

Question 16 options:

A)

x3 + 6x2+ 3x – 20

B)

x3 + 6x2 + 3x + 20

C)

x3 – 2x2 – 13x – 20

D)

x3 – 2x2 – 13x + 20
Question 17 (5 points)
Subtract: (4x3 + 9xy + 8y) – (3x3 + 5xy – 8y)
Question 17 options:

A)

7x3 + 14xy

B)

x3 + 4xy

C)

7x3 + 14xy + 16y

D)

x3 + 4xy + 16y
Question 18 (5 points)
What are the real solutions to the equation 5x2 + 29x + 20 = 0?
Question 18 options:

A)

x = –5, x = 4∕5

B)

x = –4∕5, x = 5

C)

x = 4∕5, x = 5

Answers

Step-by-step explanation:

Hey there!

Given;

[tex] = (x - 4)( {x}^{2} + 2x - 5)[/tex]

[tex] = x( {x}^{2} + 2x - 5) - 4( {x}^{2} + 2x - 5)[/tex]

[tex] = {x}^{3} + 2 {x}^{2} - 5x - 4 {x}^{2} - 8x + 20[/tex]

[tex] = {x}^{3} - 2 {x}^{2} - 13x + 20[/tex]

Therefore, Option D is correct answer.

Q.no.

Given;

[tex] =( 4 {x}^{3} + 9xy + 8y) - (3 {x}^{3} + 5xy - 8y)[/tex]

[tex] = 4 {x}^{3} + 9xy + 8y - 3 {x}^{3} - 5xy + 8y[/tex]

[tex] = {x}^{3} + 4xy + 16y[/tex]

Therefore, answer is Option D.

Qno.

Given;

[tex]5 {x}^{2} + 29x + 20 = 0[/tex]

[tex]5 {x}^{2} + (25 + 4)x + 20 = 0[/tex]

[tex]5 {x}^{2} + 25x + 4x + 20 = 0[/tex]

[tex]5x(x + 5) + 4(x + 5) = 0[/tex]

(5x + 4)(x + 5) =0

Either (5x+4)= 0,

5x = -4

X = -4/5

Or, X+5 = 0

X = -5.

Therefore, X= -5, -4/5.

Hope it helps....

What is the simplified form of (3\4)exponet3 ? Enter your answer as a fraction by filling in the boxes.

Answers

Answer:

Calculator to simplify complex fractions; fractions that have numerators and denominators, each of which are a mixed number, fraction, or integer. Solutions are given to solve the complex fraction by LCD multiplication or as Enter Mixed Numbers, Fractions or Integers  Reduce fractions where possible163−615=163−25.

Step-by-step explanation:

Find the missing value in the percent statement using a proportion.
______ is 75% of 4.

Answers

Answer: 3

Step-by-step explanation: Hope I helped

what is the best description to the relation.
A. a function that is a one-to-one
B. a function that is many-to-one
C. a function that is one-to-many
D. a relation that is not a function ​

Answers

D! Hope this helps, stay safe!

I will mark you brainliest if you go subscribe to seema beauty care and more on y o u t u b e and put the screenshot in answer.

Answers

Step-by-step explanation:

Just subscribed wish you the best on your channel!!!


polynomial expression
6x2 + 10x - 56

Answers

Answer:

-34

Step-by-step explanation:

Answer:

The answer is  34

Step-by-step explanation:

i was following the order of PEMDAS (parenthesis, exponents, multiplication, division, addition, subtraction)

so i did 6x2 which got me to 12 and then I added 10 which gave me 22, and then lastly i subtracted 56-22 which gave me 34.

~Hope this explanation has helped you, have a great day/ night!~

I GIVEEE BRAILILSTTTTTTTT

Answers

Answer:

umumumuykik.iu.fg

Step-by-step explanation:

lui;iou;uyfluylfuy;lui;uy;

When using a number line, in which direction should you move when subtracting a negative value?

Answers

Answer:

LEFT

Step-by-step explanation:

Answer:

Move to the right when you're subtracting a negative number.

A standard train ticket in a certain city costs $1.50 per ride. People who use the train also have the option of purchasing a frequent rider pass for $17.25 per month. With the pass, a ticket costs only $0.75 per ride. How many train rides a month make the frequent rider pass a better deal than standard train tickets?

Answers

Just off the bat 17$is 12 rides and then 17.25 +0.75 is 18 so 13 rides

x = number of rides per month.

Without the pass, the cost per ride is 2.00 per ride.

With the pass, the cost per ride is 1.25 per ride plus 15.75 per month.

You want to know at what number of rides does the cost per ride using the pass become cheaper than the cost per ride without using the pass.

The formula for total cost is as follows:

without the pass:

C1 = 2*x

with the pass:

C2 = 15.75 + 1.25*x

You want to know when C2 becomes less than C1.

C2 < C1 is the inequality equation you are looking for.

Since C2 = 15.75 + 1.25*x, and C1 = 2*x, this equation becomes:

15.75 + 1.25*x < 2*x

Subtract 1.25*x from both sides of this equation to get:

15.75 < 2*x - 1.25*x which becomes:

15.75 < .75*x

Divide both sides of this equation by .75*x to get:

15.75/.75 < x

Simplify to get:

21 < x

21 < x is the same as x > 21.

Your answer is the C2 becomes cheaper than C1 when x > 21.

If you make x = 21, then:

C1 = 2*21 = 42
C2 = 15.75 + 1.25*21 = 15.75 + 26.25 = 42

They are equal.

If you make x = 22, then:

C1 = 2*22 = 44
C2 = 15.75 + 1.25*22 = 15.75 + 27.5 = 43.25

43.25 is cheaper than 44 so C2 is cheaper than C1, confirming that the equation is good.

Pls give the right answers
Pls help
Pls help
Pls help

Answers

Answer:

H

Step-by-step explanation:

Because I’m decimal if it is negative the greater the number in negative the less it is

URGENT!!!! Han earns $48 for babysitting 3 hours. How much money does Han make per hour? Explain
your reasoning. :)

Answers

Answer:

Step-by-step explanation:

If he earns $48 dollars in 3 hours, you need to divide 48 by 3 to work out how much he makes per hour. and 48/3 = 16. So he makes $16 dollars an hour.

Answer:

16$

Step-by-step explanation:

You would have to divide the number of hours he worked for three days by the days he worked in order to find out what he would earn per hour.

This means the answer is 16 dollars per hour.

Find the arc length of the semicircle. 8

Answers

Answer:

π×8² =

201.0619298297

arc length formular = π ×r²

I will give you a good amount of points if you answer this correct​

Answers

Answer:

I think the answer is B. The equation has infinitely many solutions.

Step-by-step explanation:

4(3x + 4) = 15x + 12 - 3x + 4

*group like terms so 4(3x+4) = 15x - 3x + 12 + 4

*add similar elements 15x - 3x = 12x

*add the numbers 12 + 4 = 16

*Expand to 12x + 16 - 16 = 12x + 16 - 16

*You simplify 12x = 12x

*Subtract 12x from both sides

*Then Simplify which is 0

Which means Both sides are equal to 0

True for all X

800 adults were surveyed to find out how many notes per week they cook dinner 60% indicated that they cooked dinner more than four nights at per week based on the results of the survey how many adults out of a group of 2000 to cooked dinner more than four nights per week

Answers

Answer:

1200

Step-by-step explanation:

60                 x

-              =    -

100               800

There are 2 ways to solve this.

1) 800 x 60= 48,000

Divide by 100= 480

x=480

2)  Multiply 60 by 8.

Now there are another 2 ways to go.

1) 480        x

   -        =   -

  800        2000

OR

2) 60            x

   -          =    -

   100           2000

I recommend the second option for both. It is easier. The second option allows you to find and equal ratio, with less of the hassle.  

To get 2000, 100 must be multiplied by 20. So.... multiply 60 by 20 to get a equal ratio.

Your answer is 1200. Meaning 1200 adults cooked dinner more than four nights per week.

I hope this helps you significantly

~~~LampteyJ

Answer:

1200

Step-by-step explanation:

Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5, and a drink for $2. Write an expression for the total cost of the trip to the movies. Then find the total cost.

Answers

Answer:

Tyree and all of his friends get 1 ticket for $7. Next they all get 1 snack for $5. Then they all get a drink for $2. So:

1=7

1=5

1=2

Then you take each person (which there are five of then) and you times all five people by 7, 5, 2.

5 x 7=35

5 x 5=25

5 x 2=10

After that you add it all together:

35 plus 25=60

60 plus 10=70

Step-by-step explanation:

your welcome

Answer:

Im not sure if it ment, Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning only one snack), and a drink for $2. (Meaning only one drink) or if it ment Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning everyone got a snack), and a drink for $2(meaning everyone got a drink). So i did the math for both of them, if they only got 5 tickets, one snack, and one drink, it would be 42 (the math problem is 35 + 2 + 5). if they got 5 tickets, 5 snacks, and 5 drinks, it would be 70(the math problem is 35 + 25 + 10). Hope this helps!

Question 16 please help me

Answers

The answer is 32.8 this is because using the Pythagorean it’s a”

1. A store sold 700 motorcycles last year. This year the store sold 820 motorcycles. What is the percent change in the number of motorcycles sold from las year to this year?​

Answers

Answer:

120 or 120%, hope this helps!

Step-by-step explanation:

3x3z−6z for z=5 solve pllllsslssss

Answers

hi luv!!!
i’m doing the problem right now, so in the first part. do you want me multiply 3x with 3z?

-4 > x - 3 find x in the equation

Answers

Answer:

X= -1

Step-by-step explanation:

Kenny drank 37 ounces of milk during the
day. How many cups of milk did he drink?

Answers

Answer:

4.625

Step-by-step explanation:

that is the answer

PLEASE ANSWER THIS ASAP, I WILL BE GIVING YOU A THANKS!

Answers

Answer:

I would say D. There is no logical explanation for the final answer but there is for everything else.

For A: Makes sense because 3x-2 are in parenthesis outside a number so you can multiply.

For B: Makes sense because you are allowed to add/subtract like terms but in this case only subtracting would make sense, (which is what they did) since you want to get all the like terms on one side.

For C: Makes sense because you are trying to simplify the equation, and they are both like terms (they are both numbers that have no letter attached to them) and they are on the opposite side making them able to be simplified.

For D: No idea what the point is.

Write an expression that represents the number of shells in pile 2.

Answers

Answer:

2

Step-by-step explanation:

4/2=2

Other Questions
3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Identify the number of solutions for the equation below: A game store owner buys a Nintendo Switch game for $22.50 and sells it with a 40% mark up. What is the retail price? What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? Which action best explainsthe differences shown inthese photographs? Chooseyour answerand explainwhy you chose itA The United States gaveeconomic assistancethrough the Marshall PlanB The United States and theSoviet Union created analliance after World War IIC The United Nations wascreated after World War ILD The Soviet Unioncreated the Iron Curtainafter World War II