PLEASE HELP!! BRAINLIEST
When it comes to forensic science, which statement would be an example of modernist thinking?

The suspect's DNA seems to match the sample picked up at the crime scene but since technology is always changing, it might not really be a match.

Yes, the suspect's footprints were found at the scene of the crime, but the suspect lives close and might have walked there another time.

The gun has been fired 17 times and all 17 bullets match the bullet in the victim, so that proves it is the murder weapon.

The fingerprint found at the scene may appear to be a match, but there is no guarantee that this is the correct suspect.

Answers

Answer 1

Answer:

the first one, "the suspect's DNA seems to match the sample picked up at the crime scene but since technology is always changing, it might not really be a match."

Explanation:

scientists and investigators that work in forensics can use short tandem repeat (STR) which identifies individuals. this is the most accurate way to find a suspect.

hope this helps!!


Related Questions

Who is Lisa greenbaum in three miles podcast

Answers

Answer:

Lisa Greenbaum is a teacher from the public school, University Heights High School from South Bronx.

Explanation:

"Three Miles" is a radio podcast in the series "This American Life". It tells the story of how two teachers from two very different schools 'experimented' with an exchange program to help their students discover how different lives are.

Lisa Greenbaum is a teacher from a public school, University Heights High School. Along with Fieldston High School's teacher, Angela Vassos, Lisa embarked on the special 'exchange program' to help their students understand how different life can be. Though both schools are located in the Bronx area of New York, one school is a public school with little to no facilities while the other is an elite private school.  

need help answer all three to get brainliest

Answers

Answer:

I think it's false, true and true

the last one is true

Why are unfunded mandates difficult for states to deal with

Answers

Answer:

it cuts funds unmarked for programs

Explanation:

PLSS HELPPP me think of an essay title....What is a good title for an essay about anti asian hate crimes and violence like i can't think of a title that is convincing, descriptive and captivating

Answers

Answer:

Stop Asian and violence

Explanation:

Answer:

A Rising Tide of Hate and Violence against Asian Americans ...

Explanation:

Why would an investor want to choose a certificate of deposit over a corporate bond

Answers

Certificates of deposit are really loans investors make to financial institutions. With CDs investors can also select the length of maturity, giving them an opportunity to tailor the expiration date to future expenditures such as college tuition, a vacation, or some other expense.

Brainliest or a thank you please :)) <3

Did the Mongols invaded Korea known as Gloria all the time on several occasions between the year 1231 and 1270 which statement is true of those invasions

Answers

don’t believe the person above me it’s a scam . it’s also annoying i’m sorry about that

who was the first person to make the hair dryer?! i need halo asap it is due in 30min​

Answers

Answer:

Alexander Godefroy

Explanation:

Complete the sentence with the future perfect form of reach.

Answers

Answer:

will have reached

Explanation:

will have v3

this is the structure for future perfect tense

V3 for reach is reached

In 1948, what type of government returns to China?

Democracy or Communism

Answers

Answer:

In most cases the surrounding countryside and small towns had come under Communist influence long before the cities. Finally, on 1 October 1949, Communists led by Mao Zedong founded the People's Republic of China

Explanation:

PLZ HELP WILL GIVE CROWN

Who Killed Mama Roma? Opening Statement
Write in complete sentences. Use your own words. Think of this as the “opening statement” of the trial of your suspect. It should be clear, concise, and thoughtful. It should also be AT LEAST ONE FULL PARAGRAPH.

Answers

Answer:

Roma, and Lotti Fundia were the conspiritors involved in the murder. Each person played a part in the team. They are all equally guilty for the murder, though. Mama died from a stab wound to the back and chronic lead poisoning.

Which diagram most effectively shows how a voter influences policy?
A.
A voter decides
her vote doesn't
make a
difference.
She doesn't vote,
and the current
mayor is
reelected.
B.
A voter serves
on a jury.
He decides he
has an opinion
about the death
penalty in his
state.
C.
A voter learns
about national
issues.
She makes an
informed choice
to vote for a
candidate she
agrees with
D.
A voter registers
to vote
He increases his
local voter
tumout slightly.

Answers

Answer:

c

Explanation:

The option that shows how a voter influences policy is option c. A voter learns  about national  issues She makes an  informed choice  to vote for a  candidate she  agrees with.

The voter in an election is a person who has the power to choose who her representatives in the government should be.

When a citizen votes for a particular person they vote based on the fact that they agree with the political ideology of the person.

Read more on https://brainly.com/question/15655688?referrer=searchResults

Select the correct answer from each drop-down menu.
What are Reserve Banks?
Reserve Banks are ____
that help the ____
carry out its duties.

1st blank) commercial
Investment
Regional

2nd blank) central
Government
State

Answers

Answer:

Reserve banks are regional banks that help the central bank to carry out its duties.

Reserve Banks are regional ones that help the central carry out its duties. Thus, the first blank is "Regional" and the second blank is "Central".

Reserve Banks are regional institutions that operate within a centralized banking system to assist the central bank in carrying out its duties. In the United States, for example, the Federal Reserve System consists of several Reserve Banks located in different regions across the country.

These regional Reserve Banks serve as the operating arms of the central bank, implementing monetary policies, supervising and regulating banks within their respective regions, facilitating payment systems, and conducting economic research. They act as intermediaries between the central bank and commercial banks, playing a vital role in maintaining the stability and effectiveness of the overall monetary system while catering to the unique needs and characteristics of their specific regions.

Learn more about Reserve Banks here:

https://brainly.com/question/30828091

#SPJ6

Becky and Eric are best friends and are taking the same sociology course. They have formed a study group to prepare for the tests. As the course progresses, Becky tends to earn much higher test grades and discovers that Eric has found out that she scores higher on the tests. Becky wants to continue to do well in the class, but she doesn't want to make Eric look or feel bad. It is likely that Becky is experiencing

Answers

Answer:

Becky is experiencing role strain

how does pop culture affect our society?

Answers

Answer:

pop culture affects our society by influencing what people do.. such as fashion trends and social media. hope this helped you!!

Pop culture informs how people make sense of the world. It reveals what society believes about itself, but it can also be used as an instrument for effecting social change. “It's an interface with the world and a vehicle (for) education … Studying pop culture teaches us something new by challenging us to critically consider the society we live in. The study of pop culture helps us to gain empathy by recognizing ourselves in each other.

How does culture affect learning?

Answers

Answer:

Culture encompasses both what people do and what they believe. Culture has a significant impact on how we perceive the universe, attempt to comprehend it, and interact with one another. As a result, learning and teaching styles are heavily influenced by tradition.

Explanation:

Answer:

How does culture impact learning? ... Culture includes what people actually do and what they believe. Culture influences greatly how we see the world, how we try to understand it and how we communicate with each other. Therefore, culture determines, to a great extent, learning and teaching styles

please mARK MEH BRAINLEST AT LEAST MAKE MY :]

1. Which statement about the Russian constitution is true?
a. It limits the power of the government.
b. It states that people have freedom of speech.
c. It prevents the right to education.
d. It states that citizens cannot own their own houses.

Answers

Answer:

B.

Explanation:

The statement which is true about the Russian Constitution is that it gives its people freedom to speech.

In Article 29 of the Russian Constitution, states the the citizen of Russia shall be guaranteed the freedom of ideas and speech. The freedom of expression and speech is the slowly eroding freedom guaranteed by the Russian constitution.

Therefore, option B is correct.

When sodium and chlorine are mixed

Answers

Answer:If sodium metal and chlorine gas mix under the right conditions, they will form salt. The sodium loses an electron, and the chlorine gains that electron. This reaction is highly favorable because of the electrostatic attraction between the particles. In the process, a great amount of light and heat is released.

Explanation:

How did the Savannah River play an enormous role in the creation of the colony of Georgia

Answers

Answer:

It played an enormous role in the creation of the colony of Georgia

By supplying it with hydroelectric power, recreational opportunities to sports enthusiasts.

Explanation:

It supplies hydroelectric power to growing businesses. It provides exciting recreational opportunities to sports enthusiasts. The river continues to support Georgia's economy. It is a state treasure that must be guarded.

The river provides drinking water to two of Georgia's major metropolitan areas, Augusta and Savannah, and assimilates their treated wastewater. It is also a source of drinking water for the cities of Beaufort and Hilton Head in South Carolina and for many smaller municipalities in the basin.

If you also need to answer another question about How did the Treaty of Savannah impact the colony of Georgia? Here is your answer.

On this day in 1733 at a meeting in Savannah, delegates from each of the eight principal towns of the Lower Creeks signed the Treaty of Savannah officially allowing James Oglethorpe's colonists to “make use of and possess all those lands which our nation hath not occasion to use"

Have a great day, hope this helps!!!!!!

2. Which ethic do you think is most important for a journalist to have? Why?

Answers

Answer:

Media ethics is the best division of applied ethics dealing with the specific ethical principles and standards of media, including broadcast media, film, theatre, the arts, print media and the internet. The field covers many varied and highly controversial topics, ranging from war journalism to Benetton ad campaigns.

Answer:

I think Fairness is most important for a journalist to have. If journalists don't be fair while writing or reporting the events, then they won't have accuracy, honesty, objectivity, and probably safety. If the journalist don't be fair, they could write or report something that is the true facts and they wouldn't present from a objective way. The journalists might also put other people in trouble. What is the point of still having the journalists if they just get some goods from people and write what the people wanted. All ethics are important for journalists, and journalists should try their best to follow them. If journalists have all the ethics, their article will be reliable and trustworthy, which means they could have a lot of audiences and readers. On the other hand, if a journalist does not follow any ethic, they would have fewer audiences and their articles are not trustworthy.

Explanation:

This is my answer only.

Change it to a way you like it to avoid plagiarism.

Pls give brainliest if this helps!

Explain what political system are

Answers

Answer:

In political science, a political system defines the process for making official government decisions. It is usually compared to the legal system, economic system, cultural system, and other social systems.

Answer:

its mean to make decision by government

Which government type is "for the people, by the people; have voting and the people have personal freedoms?

Answers

Answer:

Explanation:

democracy?

Democratic government

Which one of the following suspicious deaths should include the measurement of bone length and nutrient content of the bones?


studying the remains of a prisoner who is thought to have died due to poisoning

investigating a suspicious drowning

identifying diseases that caused several deaths among the pioneers who traveled the Oregon Trail

investigating the death of a child whose body is extremely small for its age and who lived with a parent who was known to gamble with the family's food money

Answers

Answer:

Investigating the death of a child whose body is extremely small for its age and who lived with a parent who was known to gamble with the family's food money

==================================================================

Hope I Helped, Feel free to ask any questions to clarify :)

Have a great day!

More Love, More Peace, Less Hate.

    -Aadi x

Answer:investigating the death of a child whose body is extremely small for its age and who lived with a parent who was known to gamble with the family's food money

Explanation:

on quizlet and took it on edg

What is an “Unrestricted Submarine Warfare”? ( In your own words )

Answers

Answer:

a free for all submarine war

Explanation:

where you shoot spears out the sub at the other subs last one to sink loses (hopefully not there lifes) but everyones required to wear scuba gear incase your sub starts flooding so you can safely escape.

If the demand for high-definition televisions increases, you can expect their price to (3 points)
increase
not change
cut in half
decrease

Answers

Answer:

a

Explanation:

Name three rights you have under the Bill of Rights

Answers

Freedom of speech,

Freedom of the press, and

Freedom of religion,

Hope this helped!

(~ ̄▽ ̄)~

what are the impact in increasing number of social grant on the teenage motherd​

Answers

Answer:

teenagers may start to get intentionally pregnant to get money

Sometimes, when social grants to teen mothers are increased, their social lives are impacted negatively.

What is a social grants?

A social grants is a government fund that aims to redistribute wealth to create a more equitable society

The teen mothers might see themselves as burdens to the society when they receive the grant.

In conclusion, the social grant might cause them to withdraw from social life due to the shame and low self-esteem they often experience.

Read more about social grants

brainly.com/question/4869427

How does a pollutant affect the environment

Answers

Answer:

Pollution may muddy landscapes, poison soils and waterways, or kill plants and animals. Long-term exposure to air pollution, for example, can lead to chronic respiratory disease, lung cancer and other diseases. Toxic chemicals that accumulate in top predators can make some species unsafe to eat.

Explanation:

Nora has a quick temper, overreacting in anger every time one of her classmates does something she doesn't like. Her teacher suggests that whenever another student annoys her, she should (1) stop to decide what behavior in particular is bothering her, (2) think about several possible ways of responding to the behavior, and (3) choose the response that is most likely to be both productive and prosocial. In self-regulation terminology, the teacher is trying to promote ________ in Nora.

Answers

Explanation:

How she can control her anger

1. Which of the following does not indicate the accounting equation correctly?
1.Assets-Liabilities - Equity
2.Assets = liabilities + equity
3.Equity-Liabilities = Assets
4.Assets- Equity Liabilities​

Answers

Answer:

3. Equity - Liabilities = Assets

Explanation:

The accounting equation is one that shows the relationship that exists among equity/ capital, assets and liabilities of an entity. It can be used to determine any of the three variables if the values of two are known.

The equation is given as:

Equity = Assets - Liabilities

i. We can say;

Assets - Liabilities - Assets = 0 (which is expression 1)

ii. We can say;

Assets = Equity + Liabilities (which is expression 2)

iii. We can say also that:

Assets - Equity = Liabilities (which is expression 4)

Thus in the given question, expression 3 does not indicate accounting equation.

key roles of a professional teacher​

Answers

Being a barb purrrrrrrrrrrrr...
Other Questions
Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Classify the real number.[tex] \sqrt{15} [/tex] Please help! Thank you! Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST Clasifica cada uno de los siguientes incisos como sustancia pura (elemento y compuesto) o mezcla (homognea y heterognea). Explica brevemente. (a) arroz con leche (b) agua de mar (c) magnesio (d) gasolina ?????????????????????????? need help please hurry Lines a and b are parallel. The slope of line b is 1/3 . What is the slope of line a? Which of these are part of the electromagnetic spectrum?Question options:gamma raysvisible lightmicrowavessound wavesradio waves Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years.