PLEASE HELP I REALLY NEED THIS DONE FAST!! BRAINLIEST!!! 50 POINTS PER PERSON!!! I WILL MARK BRAINLIEST TO WHOEVER GIVES A GOOD ANSWER THAT HAS MET THE REQUIREMENTS OF THE INSTRUCTIONS!!!
You will write a position paper (your Own opinion) expressing whether you are FOR or AGAINST the building of roads in Rainforests.

You might need to do a little research on Rainforests but if you already have knowledge on this topic then that's great. Find out why people have cut down trees and ruined the Rainforests and why they built roads in it. This is an Opinion paper, so there is no wrong answer if you pick either side but please still make the answer a good one. Just express your opinion on whether you are FOR or AGAINST the building of roads in the rainforest. It has to be 2 paragraphs of 4 sentences or more.
Please remember I WILL BE GIVING BRAINLIEST TO THE BEST CORRECT AND GOOD ANSWER!!!

Answers

Answer 1

Answer:

We live in an era of unprecedented road and highway expansion — an era in which many of the world’s last tropical wildernesses, from the Amazon to Borneo to the Congo Basin, have been penetrated by roads. This surge in road building is being driven not only by national plans for infrastructure expansion, but by industrial timber, oil, gas, and mineral projects in the tropics.

Few areas are unaffected. Brazil is currently building 7,500 kilometers of new paved highways that crisscross the Amazon basin. Three major new highways are cutting across the towering Andes mountains, providing a direct link for timber and agricultural exports from the Amazon to resource-hungry Pacific Rim nations, such as China. And in the Congo basin, a recent satellite study found a burgeoning network of more than 50,000 kilometers of new logging roads. These are but a small sample of the vast number of new tropical roads, which inevitably open up previously intact tropical forests to a host of extractive and economic activities.

Explanation:

Answer 2

Answer:

Deforestation on rainforests and other natural environments can have a devastating effect on the whole world. First, it leads to the loss of many animal and plant species, decreasing the biodiversity that our planet enjoys. It can also lead to the degradation of soil and to erosion, as trees and plants usually hold the ground in place and provide necessary nutrients to it. Deforestation also has a negative effect on climate change, as trees are able to absorbe an enormous amount of greenhouse gas emissions. Without them,  the greenhouse effect is amplified, worsening climate change.

Explanation:


Related Questions

b. Why is it possible to move the object that way?

Answers

there’s is no question there’s only an answer there’s nothing to explain

Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

What is the role of DNA in an organism ? how is dna related to reproduction​

Answers

Answer:

DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce. 

How is the organism in bread used?

Answers

Answer:

yeast

Explanation:

i think............................

I'm not sure

Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?

mouth-- stomach-- small intestine-- large intestine-- rectum

rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth

mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum

mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum

Answers

This is hard ........!!!!!!

Answer:

mouth--esophagus--stomach--small intestine---large intestine---rectum

Explanation:

explain how gas is compressed into liquid in a gas barrel

Answers

Explanation:

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. ... In liquids, the molecules are very near than that of gases.

Which sex cell is produced in males?

Answers

Answer:

Sperm

Explanation:

Answer:

Sperm

Explanation:

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.

Answers

Answer: D

Explanation:

Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.

Place the appropriate terms into the table

Answers

Answer:

Kindly, provide us with a table, thank you! :)

Explanation:

Can we see the table lol? :)

What are the differences between parents and offsprings ?

Answers

Answer:

Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.

Answer:

Parents have offspring

Explanation:

Offspring is the result of sexual or asexual reproduction by parents.

Germination will not happen unless a seed

A. is dispersed far from the plant that produced it.
B. absorbs water.
C. uses its stored food.
D. grows stamens and a pistil.

Answers

I think it’s B. Absorbs Water

DNA is a molecule that stores____information in the cells

Answers

Answer: instructions

Explanation: trust me

Answer:

genetic

Explanation:


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?

A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.

B It hasn't rained enough and the plants aren't getting enough water.

C The factory has increased the temperature in the area.

D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.

Answers

Answer:

D

Explanation:

If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

In guinea pigs, the allele for black fur(B) is dominant over the allele for
brown fur(b), and the allele for short fur (F) is dominant over the allele
for long fur(1). What percent of the offspring of a BbFf x bbff cross will
be heterozygous for both traits?
Select one:

100%
25%
0%
50%

Answers

Answer: 50%

Explanation:

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

which two technologies use reflected sound waves

Answers

Answer:

one of them is SONAR

Explanation:

Other one is megaphone

Answer: There are 3 of them that are: radar, sonar and lidar.

Explanation: I used google to answer this

Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.

Answers

Answer:

I think it is glucose.i hope this helps!

Explanation:

Answer:

the correct answers are glocose, respiration, and oxygen

Explanation:

i got it right


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

What percentage of Japan’s population is between the ages of 0–4 years?

Answers

Answer:

looks like about 8% to me

40 to 44 percent of people are in the range of 0 to 4 years.

What is the population?

A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.

In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.

In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.

Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.

To learn more about the population, refer to the link:

https://brainly.com/question/27991860

#SPJ2

WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?

4x + y = 4
2x + 7y = 28

4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28

Answers

Answer:

D.

Explanation:

Answer:

D

Explanation:

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

The water cycle gets its energy from the ___?

Answers

Answer:

the sun

Explanation:

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

Other Questions
Angle a =8x+6 Angle b= 4x+38Solve for x and find the measure of angle b In the space below, list five potential topics for your research paper. For each of thesetopics, write down one big question that you want to answer in your paper. Write down all the factors of 15. Mitch runs 4 miles in 2x + 3 minutes, and Joyruns 7 miles in 5x - 1 minutes. If each of themran for 1 minute, how many miles would theyrun, combined (in terms of x)? Your job as a researcher for a college is going well. You have gained confidence and skill at pulling data and you are not making as many rookie mistakes. The college executives are begging to take notice of your skills. The college has had serious problems with reporting in the past for several reasons. One problem is there was no centralized department for numbers. Human Resources did some reporting, financial aid another, and the rest was covered by the registrars office. It was difficult to determine simple things like number of students enrolled in the fall semester because different departments would generate different. The higher ups want one consistent number they can rely on and they think your department should be in charge of generating that number. As the first report as the official office numbers they want you to generate a report that tracks student demographics over time (a longitudinal study). Your college has a large percentage of its student body who are affiliated with the military (active duty military, retired military, military spouse, military dependent). For this study the college executives want to see how they stack up to other colleges that have a large percentage of military students. After doing some research you find a field in the database that named mil_status. The documentation you have on the field says this is the field you are looking for. Since you need to determine when the student was in the military to generate this report you look for a start and end date associated with mil_status. Sure enough the table also has a mil_status_start and a mil_status_end field. These fields when combined with enrollment data allow you to determine if a student was in the military when they were a student. You query the data to check for bad dates and discover a serious issue. Most of the start dates and end dates are NULL. You once again make some quick phone calls to find out whats going on. It seems this field is not populated unless the college receives official paperwork from the military listing the soldiers enlistment date. In addition to this you find out that students are not required to update their information ever semester. This means once their mil status is set it is unlikely to ever change. Based on this information prepare a post that addresses the following: 1) What recommendation(s) would you make to the colleges executives to address this issue? 2) Collecting this data will have tangible and intangible costs associated with it. For example requiring official paper work adds an extra burden on registration and on the student. Students may decide to go elsewhere instead of supplying the paperwork or may stop identifying themselves as military. The executives want the data but they dont want its collection to impact enrollment or place an undue burden on registration (the line is long enough already). How would you respond to these concerns?3) You noticed something odd in the mil_Status field. The possible values are "Active Duty Military", "Military spouse", "Retired military", "Military Reserves", and "Military dependent". In what way is this field problematic? How could you fix it? what is the volume of a hemisphere with a radius of 6? What is the value of n?In= 55 onlyO and 5-5 or 5-5 only Helpppp ASAP The graph of f(x) = x^2 was transformed to create the graph of g(x) = f(x) - 9. Which statement about the graphs is true? A.The graph of g is a reflection of the graph of f across the x-axis.B. The vertex of the graph of g is 9 units to the right of the vertex of the graph of fC. The y-intercept of the graph of g is 9 units below the y-intercept of the graph of f.D. The graph of g is a reflection of the graph of f across the y-axis. PLZ HELP, I'LL GIVE EXTRA POINTS1. Which of the following can reduce biodiversity within a natural environment?A.Giant kangaroo rats enrich the soil for plants with their piles of grass clippings in the California grasslands.B.Grasslands in the California Floristic Province have been converted into housing projects, shopping centers, and roads.C.Acacia trees of Central and South America provide food for stinging ants, while the stinging ants sting other insects on the trees.D.In Japan, hummingbird hawkmoths drink nectar from a species of flowering plants and transfer the plants' pollen to other flowering plants of the same species. 2. ExitWhich was the MOST likely consequence of introducing the Japanese kudzu into the eastern United States?A.Kudzu now depends on the native shrubs for survival.B.The native mature trees now depend on kudzu for sunlight.C.The native mature trees kill kudzu by choking the vines and uprooting them.D.Kudzu kills native shrubs by smothering them under a solid blanket of leaves.3. The acacia tree species and the stinging ant species of Central and South America depend on one another for survival in many ways.Which is the MOST likely consequence if the number of stinging ants in Central and South America decreased for some reason?A.The number of acacia trees would increase.B.The number of acacia trees would decrease.C.The number of acacia trees would stay the same.4. Which of the following can reduce biodiversity within a natural environment?A.Yucca moths pollinate and feed on yucca plants in the Mojave Desert.B.Red-billed oxpeckers eat ticks off of impalas' coats in the grasslands of East Africa.C.Non-native American bullfrogs out-compete native amphibians in the Tropical Andes.D.Giant kangaroo rats enrich the soil for plants with their piles of grass clippings in the California grasslands.5. Which of the following describes how different species depend on one another in a natural environment?A.Non-native kudzu out-compete native plants in the eastern United States.B.Giant African snails imported as pets damage native plants and crops in Hawaii.C.Grasslands in the California Floristic Province have been converted into housing projects, shopping centers, and roads.D.Acacia trees of Central and South America provide shelter for stinging ants, while the stinging ants snip surrounding plants that grow too close.6. Which of the following describes how different species depend on one another in a natural environment?A.Non-native kudzu out-compete native plants in the eastern United States.B.Giant African snails imported as pets damage native plants and crops in Hawaii.C.Australian light brown apple moths damage crops and native plants in California.D.Giant kangaroo rats enrich the soil for plants with their piles of grass clippings in the California grasslands.7. Why is the destruction of a natural environment a risk to the survival of humans?A.Humans depend on many species for food.B.Humans depend on many species for technology.C.Humans depend on natural environments for landfill space.D.Humans depend on natural environments for scrap-metal yard space.8. Which is a major threat to biodiversity?A.Red-billed oxpeckers eat ticks off of impalas' coats in the grasslands of East Africa.B.Mining in the Guinean Forests of West Africa to provide diamond and gold jewelry for humans.C.Acacia trees of Central and South America provide food for stinging ants, while the stinging ants snip surrounding plants that grow too close.D.In Japan, hummingbird hawkmoths drink nectar from a species of flowering plants and transfer the plants' pollen to other flowering plants of the same species. 9. Which describes a natural environment with the greatest biodiversity?A.10 red squirrels, 20 bristlecone pine treesB.55 bristlecone pine trees, 30 snowshoe rabbitsC.25 snowshoe rabbits, 100 bristlecone pine trees, 5 red squirrelsD.10 red squirrels, 45 snowshoe rabbits, 100 bristlecone pine trees10. The acacia tree species and the stinging ant species of Central and South America depend on one another for survival in many ways.Which is the MOST likely consequence if the number of acacia trees in Central and South America decreased for some reason?A.The number of stinging ants would increase.B.The number of stinging ants would decrease.C.The number of stinging ants would stay the same. Expand. Your answer should be a polynomial in standard form. (x-4)(x-6) Your client has $80,000 invested in stock A. She would like to build a two-stock portfolio by investing another $80,000 in either stock B or C. She wants a portfolio with an expected return of at least 15% and as low a risk as possible, the standard deviation must be no more than 25%. Expected Return Standard Deviation Correlation With A A 18% 30% 1.0 B 17% 25% 0.3 C 15% 15% 0.4_____ A Sense of Proportion: Saturn is about 60,000 km in radius, and its rings are only about 0.01 km thick with ripples 100m high. Design a really big model with Saturn 60 inches in radius (10 feet in diameter). How thick must the rings be in your model and how high can the ripples be The day after the British burned most of the government building in Washington, DC, something shocking happened: (A) President Madison surrendered, (B) the Americans counterattacked and retook the city, (C) a strong hurricane hit the city. What are many earthquakes intended to do? Help me I will give you brainliest!!!! Please click the attached file.I would really appreciated it if someone did this. g Tanning Company analyzes its receivables to estimate bad debt expense. The accounts receivable balance is $276,000 and credit sales are $1,000,000. An aging of accounts receivable shows that approximately 3% of the outstanding receivables will be uncollectible. What adjusting entry will Tanning Company make if the Allowance for Doubtful Accounts has a credit balance of $2,200 before adjustment? The most heavily populated province in Canada is British Columbia.TrueFalse What is the function of the sepal? The sepal fertilizes the egg.O The sepal protects the bud.The sepal produces pollen.The sepal disperses the seed. How have humans affected the environment?