Please help I will mark brainlest

Find the sum of 1+2+3+4...19



Spam answer will be reported

Answers

Answer 1

Answer:

190

Step-by-step explanation:

1+2+3+4......19=210-20

=190


Related Questions

P(x)=1−2x2+3x+2x5 what type of polynomial is this?

Answers

There is only one x with no powers
P(x) = 3x + 7 a linear function

Tina is making a cylindrical sandbox that has a radius of 2 feet. She brought 18.84 cubic feet of the sand for the sandbox.

Answers

The answer is 1.5 ft

I just took the test

HELLLLLLPPPPP!!!!!!!!!!!!!

Answers

Answer:

Acute angled and scalene because if the sum of two angles is 110 then the third angle should be 70 which is acute angle

acute-angled and isosceles

Can y’all help me find the volume of this?

Answers

Answer:

1795.5 [tex]m^3[/tex]

Step-by-step explanation:

find area of base (it's a trapezoid)

[tex]\frac{b_1+b_2}{2} *h\\\\=\frac{11+16}{2} *9.5\\\\= 13.5*9.5\\\\=128.25[/tex]

multiply area of base by height

128.25 x 14

= 1795.5 [tex]m^3[/tex]

5.Stephanie and Ryan go together to a local video store. Stephanie rents two movies and three
games for a total cost of $24.30. Ryan rents three movies and one game for a total cost of
$18.25. How much does it cost to rent one movie? How much does it cost to rent one game? Show your work

Answers

Movies: $4.35. Games: $5.20

Assume movies are all $x and games are all $y to rent
2x + 3y = 24.3
3x + 1y = 18.25

Multiply second equation by 3
9x + 3y = 54.75

Subtract first equation from third equation
7x = 30.45
x = 4.35 So a movie costs $4.35 to rent

Substitute for x in equation 2
3 x 4.35 + y = 18.25
13.05 + y = 18.25
y = 18.25 - 13.05 = 5.20 so games cost $5.20 to rent

You own a house with an appraised value of $300,000. Your equity in the home is $125,000. What is your mortgage balance?

Answers

Answer:

The mortgage balance is $175,000

Step-by-step explanation:

Remember:  House value = equity + mortgage.  Therefore,

                     $300,000     = $125,000 + mortgage balance

The mortgage balance is $175,000.

Solve the system using elimination. Show your work! (6 pts)
(7x + 10y = 11
(4x + 3y = -10

Answers

Answer:

x=-7

y=6

Step-by-step explanation:

7x+10y=11

4x+3y=-10

-3(7x+10y=11

10(4x+3y=-10

-21x-30y=-33

40x+30y=-100

19x = -133 (divide 19 on both sides)

x= -7

Now put the x in one of the original questions.

7(-7)+10y=11

-49+10y=11 (Add 49 to both sides)

10y=60 (Divide 10 on both sides)

y=6

These are some more questions

Answers

1) the first option
2) the third option i think
3) the second option
4) not too sure but maybe last option.

A regular polygon with exterior angle of 45° is redrawn using a scale 1 : 5. If the actual length of the sides of the regular polygon is 10cm, calculate the perimeter of the scale drawing of the regular polygon.​

Answers

Answer:

16 cm

Step-by-step explanation:

"regular polygon" means all sides and angles are the same.

the sum of all exterior angles must be 360 degrees.

so, how often do 45 fit into 360 ?

2 times in 90, which in turn fit 4 times into 360, so 8 times.

the polygon has 8 corners and 8 sides.

each side is originally 10cm

so the original perimeter is 8×10 = 80 cm

now, every side is reduced to 1/5th of the original size, this also reduces the perimeter by the same factor.

=> perimeter = 80×(1/5) = 80/5 = 16 x cm

control :

applying the scaling factor of 1/5th to every side transforms every side from 10 cm to 2 cm.

we still have 8 sides.

perimeter = 8 × 2 = 16 cm

correct

PLEASE HELP ME I AM SUFFERING GREATLY

Answers

Answer:

6 hours ( i think)

Step-by-step explanation:

new crew = 12 hours, experienced crew = 6 hours

new crew + experienced crew = 12 hours and 6 hours

the help that they get together ; 12-6

-42+(-17) simplified

Answers

Answer:

La respuesta es

Step-by-step explanation:

-42+(-17)=. - 59

Espero ayudarte suerte

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

-59  

»»————- ★ ————-««  

Here’s why:  

⸻⸻⸻⸻

[tex]\boxed{\text{Solving the Expression}}\\\\-42+(-17)\\------------\\\rightarrow -42 +1(-17)\\\\\rightarrow -42 -17\\\\\rightarrow\boxed{-59}[/tex]

⸻⸻⸻⸻

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

Pls Answer the first one and the second question

Answers

Answer:

here wo go with the answerrrrrrrrrrr

Answer:

(a) [tex]10\frac{13}{35}[/tex]

Step-by-step explanation:

[tex]\frac{1}{2\frac{4}{7} }+ \frac{1}{8\frac{4}{5} }+ \frac{1}{\frac{3}{7} }[/tex]

[tex]\frac{1}{\frac{18}{7} }+ \frac{1}{\frac{44}{5} }+ \frac{1}{\frac{3}{7} }[/tex]

[tex]\frac{18}{7} + \frac{44}{5} + {\frac{3}{7}[/tex]

[tex]\frac{40+308+15}{35}[/tex]

[tex]\frac{363}{35}=10\frac{13}{35}[/tex]

A backpack that normally sells for $40 is on sale for $38. Find the percent of increase or decrease. *20 POINTS* (PLS SHOW WORK)

Answers

Answer:mj,bhvb n

mnbnmb mbnmbnb

Step-by-step explanation:

What is the surface area

Answers

Answer:

184 m²

Step-by-step explanation:

Surface Area = 2(10*2) + 2(10*6) + 2(2*6)

Surface Area = 2(20 + 60 + 12)

Surface Area = 2(92)

Surface Area = 184 m²

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Escribe el nombre de algún tipo de ángulo que se forma "Entre Dos rectas Paralelas y una Secante"

Answers

Answer:

We see that opposite angles are two angles between two secant lines (“secant lines” simply means two lines that cross each other) that share a vertex (that is why they are called “vertical” angles). We see also that they are not adjacent (which means next to each other) but opposite each other.

Step-by-step explanation:

Vemos que los ángulos opuestos son dos ángulos entre dos líneas secantes (“líneas secantes” simplemente significa dos líneas que se cruzan) que comparten un vértice (por eso se llaman ángulos “verticales”). También vemos que no son adyacentes (lo que significa uno al lado del otro) sino uno frente al otro.

Please help me!!! I would really appreicate it but if you can't that is okay I understand :)
(MULTIPLE CHOICE)

Answers

It would be D
Because since each small square represents 2 kg. The left scale would be balanced by 10kg(2x5=10) and the left one would be 8kg(2x4=8). Therefore D would be the answer. I hope it helps)

An artist is preparing to open a gallery, but wants to have 35 finished works of
art before he opens. He creates 4 new works each week. If he already has 19
works prepared, how many weeks until he is ready to open?

Answers

Answer:

tic ishaan t,x Germany ruff hero

Help please and thank you...

Answers

Answer:

Its b) 55

Step-by-step explanation:

trust me,......

WILL GIVE BRAINLIST




AN ALGEBRAIC EXPRESSION IS ____ WHEN ALL LIKE TERMS HAVE BEEN ___


Is it


Variable/ combined

Or

Variable/ simplified


Or

Simplified / combined

Or
Combined / s impfied

Answers

Answer:

I think it will be combined and simplified

Answer:

Simplified/combined

Explanation:

In order to simplify an algebraic expression you need to combine all of the like terms which have the same variables and powers.

Copy PQ to the line with an endpoint at R.

This task will be complete when you have

drawn an arc intersecting the line to create

a segment with length PQ.

Answers

Answer: Hello your question lacks some details attached below is the complete question

answer:

Place a compass at point Q , measure arc PQ Draw an arc with the compass that is equal to PQ , Place the compass at point R ,   cut through the line to the left of R with the arc in compass, Assume the new points to be P' and R be Q' ,   where P' Q' will become the new image of PQ with their end point will be R

Step-by-step explanation:

The steps required to draw an arc intersecting the line that will create a segment with length PQ are ;

Place a compass at point Q ,  measure arc PQ

Draw an arc with the compass that is equal to PQ ,  Place the compass at point R ,   cut through the line to the left of R with the arc in compass,

Assume the new points to be P' and R be Q' ,   where P' Q' will become the new image of PQ with their end point will be R

Answer:

Set the compass width to the length PQ by putting one end on P and the other and on Q

Without changing the width, move the compass so one end is on R and the other end is on the line containing R

Draw an arc across the line using R as the center

Mark the point where the arc crosses the line as point S

RS is the copied segment.

Step-by-step explanation:

Line A has a slope of 3/2 and passes through the point (3, 3). Line B has a slope of – 1/3 and passes through the point (-4, -2). At what point does line A intersect line B? Line Aintersects line B at the point ( , ).​

Answers

Answer:

The lines meet at (-1, -3)

Step-by-step explanation:

Line A :

[tex](x_1, y_1) = (3, 3) \ ; \ slope, \ m_A = \frac{3}{2}\\\\Equation \ of \ line \ A : (y - 3) = \frac{3}{2}(x - 3)[/tex]

                             [tex]2(y - 3) = 3(x-3)\\2y - 6 = 3x - 9\\2y = 3x - 9 + 6\\2y = 3x -3[/tex]

Line B :

[tex](x_2,y_2) = (-4, -2) \ ; \ slope , m_B = -\frac{1}{3}\\\\Equation \ of\ line \ B: (y -(-2)) = -\frac{1}{3}(x -(-4))[/tex]

                             [tex]3(y + 2) = -1(x+4)\\3y + 6 = -x -4\\3y = -x - 4 - 6 \\3y = -x - 10[/tex]

Solve for x and y from the linear equation to find where line A and line B meets :

2y = 3x - 3 => 3x - 2y = 3 ------- (1)

3y = -x - 10 => -x = 3y + 10

                => x = - 3y - 10 --------(2)

Substitute (2) in (1) : => 3(- 3y - 10) - 2y = 3

                                   -9y - 30 -2y = 3

                                       -11y = 3 + 30

                                         -11y = 33

                                            y = -3

Substitute y in (2) : => x = -3 (-3) - 10 = 9 - 10 = -1

Pls help I’ll give crown

Answers

Answer:

B

Step-by-step explanation:

because area of prism = L×W×H

so

[tex] \frac{3}{4} \times \frac{5}{2} \times \frac{5}{4} [/tex]

answer is 75/32

hope this make sense:)

Answer:

Hi there uwu The answer is 75/32, also explained by the other answerer!

Step-by-step explanation:

If you place a 24-foot ladder against the top of a 20-foot building, how many feet will the bottom of the ladder be from the bottom of the building? Round to the nearest tenth of a foot. Delta math answer only :)

Answers

40 would be rounded to the nearest tenth

Hi! please help :) ty! (10 points)

Explain the difference between finding the volume of this right rectangular prism with whole unit cubes and with 1/2 unit cubes.

help is appreciated :)

Answers

Answer:

Rectangular prisms are six-sided polygons; three-dimensional shapes of which all sides meet at 90-degree angles, like a box. Cubes are a special type of rectangular prism of which all sides are the same length; this is the key difference between cubes and other rectangular prisms.

Step-by-step explanation:

i hope my answer to be appreciated!!

Help me ASAP please

Answers

Answer:

I think its D because if it has the parentheses then that would mean that it would go right or left

The difference of twice a number and another number is 5. The sum of the two numbers is 19. Find the numbers

Answers

Answer:

12 & 7

Step-by-step explanation:

12 + 7=19

12 - 7=5

Answer:

12 & 7

Step-by-step explanation:

*)Solve the system of equations:

x+y=19

x-y =5

=> 2y=14 =>y = 7

y=7 => x = 12

how do i solve this equation again?? its y=mx+b

Answers

Answer:

4

Step-by-step explanation:

add 3 to 13

then divide 16 by 4 that gives you your final answer of 4

what is the difference between the domain and the range of a function?

Answers

Answer:

The domain is all the x values of a function while the range is all the y values of a function.

Answer:

Step-by-step explanation:

The domain of a function is the set of input (x-) values for which the function is defined.  The range is the set of output (y-) values; often there are limitations.

For example, the sine function y = sin x is defined for all real x; for every input x, there is a corresponding output y.  The sine function has a limited range in that the minimum value of the sine is -1 and the max is +1.  There is no graph above y = -1 or below y = +1.

URGENT PLEASE HELP ANSWER ASAP FOR BRAINLIEST !!!!!!!!!!

Answers

1/2

Hope this helps! :)

______________

Answer:

1/2

Step-by-step explanation:

you use rise/run so its  (0,1) and (2,2) you move to the right 2 points and rise 1 so its 1/2 so its 0.50

HELP ME BEFORE I DIE!


Your adjacent is 3, your opposite is 4, and you have a 90 degree angle. Find the value of cos V rounded to the nearest hundredth, if necessary.

Answers

Answer:

0.6 or [tex]\frac{3}{5}[/tex]

Step-by-step explanation:

Using the Pythagorean theorem ([tex]a^{2} +b^{2} =c^{2}[/tex]) we get that the hypotenuse is 5.

so the cos V is adjacent over the hypotenuse. so if adjacent is 3 and hypotenuse is 5, the answer is [tex]\frac{3}{5}[/tex] which equals 0.6 in decimal form.

Other Questions
HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Describe any six risky situations youth are frequently exposed to Very tired1) The professor (teach)five classes Monday. He (be)afterward2) You (feed)the birds that we saw yesterday. Some of them (be)cardinals.first on the trail Saturday, because he (know)the way3) Andy (go)better than we did.4) The house (be)dirty after they left. We (clean)it yesterdaythe motorcycles in the garage, then they (eat)5) The boys (put)lunch6) My friends and I (find)some gold in the river. Then we (look)formore.7) 1 (like)to write poetry when I (be)eight years old.8) Charlotte and I (see) lightening in the sky Thursday night; the storm (come)fast.9) The children (go)to the park yesterday. They (stay)for two hoursoutside after it (snow)Three inches of snow (fall)10) We (play)that dayI need to past simple tense?? write a rough draft narrative essay about overcoming a challenge does anyone know the quotient of x and y