please help me with this

Please Help Me With This

Answers

Answer 1

Answer:

its 18

Step-by-step explanation:

6x3=18

Answer 2
The Area equals 18 square feet

Related Questions

what is the distance between -8 and 535 on a number line

Answers

Answer:

527

Step-by-step explanation:

because i did it in the calculator

Triangle ABC maps to triangle A′B′C′ by a 90∘ rotation counterclockwise about the origin.

If AB=61 units, BC=11 units, and AC=60 units, what is the length of A′C′?
11 units
61 units
90 units
60 units

Answers

Answer:

60 Units

Step-by-step explanation:

The length of AC does not change. Since the translation is a rotation, nothing about the size of the triangle should change. Meaning A'B'C' is still 60 units in length.

The length of the side A'C' of the triangle after rotation is A'C' =AC = 60 units

What is Rotation?

The measure of the amount a figure is rotated about the center of rotation is called the angle of rotation. The angle of rotation is usually measured in degrees. We specify the degree measure and direction of a rotation.

90° clockwise rotation: (x,y) becomes (y,-x)

90° counterclockwise rotation: (x,y) becomes (-y,x)

180° clockwise and counterclockwise rotation: (x, y) becomes (-x,-y)

270° clockwise rotation: (x,y) becomes (-y,x)

270° counterclockwise rotation: (x,y) becomes (y,-x)

Given data ,

Let the triangle be represented as ΔABC

Now , the measures of the sides of the triangle are

The measure of side AB = 61 units

The measure of side BC = 11 units

The measure of side AC = 60 units

And , the triangle is rotated by 90° counterclockwise  about the origin

The coordinates of the triangle after rotation is A'B'C'

And ,

The measure of side A'B' = 61 units

The measure of side B'C' = 11 units

The measure of side A'C' = 60 units

The length of the sides of the triangle does not change during a transformation of rotation by any degree

Hence , the measure of side A'C' of triangle is 60 units

To learn more about rotation click :

https://brainly.com/question/3956347

#SPJ3

Part A: Write an algebraic expression for 8 more than 5 times a number. (5 points)

Part B: Write a verbal expression for 4(n + 6). (5 points)

Answers

Part A: 5x + 8

Part B: The sum of 6 and a number, increased 4 times.

The algebraic expression for [tex]8[/tex] more than [tex]5[/tex] times a number will be [tex](8+5x)[/tex] and the verbal expression for [tex]4(n + 6)[/tex] will be four times the sum of a number and six.

What is expression ?

Expressions is a finite combination of symbols that is well-formed according to rules that depend on the context.

Part A ;

We have,

[tex]8[/tex] more than [tex]5[/tex] times a number

Now,

Let a number [tex]=x[/tex]

So,

According to the question,

We get, [tex](8+5x)[/tex]

So, this is the algebraic expression .

Part B ;

We have,

[tex]4(n + 6)[/tex]

So,

According to the question,

[tex]4(n + 6)[/tex] will be written as four times the sum of a number and six.

So, this is the verbal expression .

Hence, we can say that the algebraic expression for [tex]8[/tex] more than [tex]5[/tex] times a number will be [tex](8+5x)[/tex] and the verbal expression for [tex]4(n + 6)[/tex] will be four times the sum of a number and six.

To know more about expression click here

https://brainly.com/question/14083225

#SPJ3

Item 1
The table gives estimated annual salaries associated with two levels of education.

Level of education High school diploma Trade school certification
Estimated annual salary $27,500 $48,000
Based on the table, how much more money would a person with a trade school certification earn than a person with a high school diploma over a 30 year career?


$20,500

$75,500

$82,500

$615,000

Answers

Answer:A) 20,500

Step-by-step explanation: because 27,000+48,00=75,00  so you divdie that by 30 and you will get your answer of 20,500

What decimal is equal to 3/4???? ANSWER FAST!!!!!!!!!!!1

Answers

Answer:

0.75

Step-by-step explanation:

13. The product of 0.21 and 1.8 is 0.378
A) True
B) False

Answers

Answer:

true

Step-by-step explanation:

because 0.21 ×1.8 is 0.378

A cable TV/Internet/phone provider charges new customers $90 for all three services, per month, for the first year
under their 90 NOW promotion. Alice normally pays $59 for her monthly home phone service, $49 for Internet
service, and $69 for cable television
1. What are her percent savings if she switches to the 90 NOW plan? Round to the nearest percent.

Answers

Answer:

49%

Step-by-step explanation:

First find how much Alice is paying for the all three service currently.

Amount paid by Alice at present= 59 +  49 + 69 = $ 177

If she switches to 90 NOW plan, then the amount saved = 177 - 90 = $ 87

Percentage of savings = (saved amount ÷ total amount she was paying at present) * 100

          [tex]= \frac{87}{177}* 100\\\\= 49.15[/tex]

          = 49 %

Answer:

Step-by-step explanation:

I Really need help with this question!
Logan ordered a box of gingerbread cookies and sugar cookies the box included a total of 70 cookies and 60% of them were gingerbread how many gingerbread cookies did Logan get

Answers

Answer:

42

Step-by-step explanation:

60% of 70 is 42

What is the value of x?​

Answers

The horizontal value in a pair of coordinates: how far along the point is. The X Coordinate is always written first in an ordered pair of coordinates (x,y), such as (12,5). In this example, the value "12" is the X Coordinate. Also called "Abscissa" See: Coordinates.

If this doesn’t answer your question, then do you have any further information?

what is the area of the side of this house?

Answers

Answer:

25

Step-by-step explanation:

[tex]-5(3.15-\frac{21}{20} )+7[/tex]

Answers

The answer is -7/2 or -3.5

2345621874+9863412689

Answers

Answer:

12209034563 will be your answer.

Step-by-step explanation:

just add it.

Answer:

WAT TIME IS IT? IT TIME 2 USE DA CALCULATOR.

12209034563

more info can be giving on usecalculator.com

Step-by-step explanation:

Someone please please help me with this!!!

Answers

Answer:

[tex]4x {}^{2} - 36 \\ = (2x + 6)(2x - 6) \\ hence \: option \: b \: is \: correct[/tex]

help please i really need this done

Answers

Answer:

x = 33°

Step-by-step explanation:

x = 180° - 80° - 67° = 33°

above ^^^ is the right answer. the guy above me :)

Cars A and B leave the same place and travel in the same direction along a straight road. Car A travels at 60 km/h and car B travels at 72 km/h. After how long will they be at 8km apart​

Answers

The difference in speed of the two cars is 72-60 = 12 km per hour.

The time they would be 8 km apart would be 8/12 = 2/3 of an hour

1 hour = 60 minutes

60 minutes x 2/3 = 40 minutes.

The cars will be 8 km apart in 40 minutes.

Answer:

After 40 min they will be 8km apart

Step-by-step explanation:

Car A is traveling 1km per minute Car B is traveling 1.2km per minute, so Car B will gain 1km on Car A every 5 min. To be 8km apart, you calculate 5min x 8 = 40 min

FAR is to DISTANCE as DEEP is to __?__.

Answers

Answer:

depth

Step-by-step explanation:

far is a describing distance

deep is describing depth

HELP I NEED ANSWERS NOW

Answers

Answer:

I am not sure but I think it is c

Step-by-step explanation:

To reach her summer reading goal, Elisa has to read at least 30 books. The inequality b ≥ 30 represents the number of books she needs to read. Which of the following is the solution to this inequality?

Answers

Answer:

hii

have a good day for you!

Find the missing lengths!!!!!!!

Answers

Answer:

13

Step-by-step explanation:

It is a square so the length of 1 side = [tex]\sqrt{169}[/tex] =  13

Hey guys, I really need help with this question!Please no links, or I will report! Dont answer if you dont know please! ​

Answers

The second option :)

A number squared, then increased by 4, I need the equation.

Answers

See order to find out ave dvide is to research and hive

An earlier study determined that 60% of women older than age 50 have annual mammograms. To see if this proportion is still valid, we send surveys to 1000 women older than age 50. Of the 100 who respond, 70 say they have annual mammograms. What is the (estimated) current proportion of women older than age 50 who say they get annual mammograms

Answers

Answer:

The % of women above 50 having mammograms as devised from the survey is 70%.

Step-by-step explanation:

Given

60% of women older than age 50 have annual mammograms

Out of 1000 surveyed women of  age greater than 50, 100 women responded and out of these 100, 70 confirmed that they have annual mammograms

The % of women above 50 having mammograms as devised from the survey is 70%.

What is the mean absolute deviation if the mean is 15 and the majority of the data falls between 5 and 25

Answers

Don’t listen to these people thet tell you to open this file it’s a scam

Function is defined by f(x) = x2 - 4x + 8. The graph of function g is shown.
Let h represent the x-coordinate of the vertex of the graph of y = f(x). Let
represent the x-coordinate of the vertex of the graph of y = g(x). What is the
value of h-j?

Answers

The value of h -j is -5.

We have the function, f(x) = x² -4x + 8

Now, vertex

h = x = -b/2a

h = x = -(-4) / (-2)

h = x = -4/2

h= x = -2

Now, according to the graph

j = x= 3

So, h - j

= -2 - 3

= -5

Learn more about Function here:

https://brainly.com/question/30721594

#SPJ1

Is this relationship proportional or non proportional

Answers

Non-proportional because all the dots are scattered I believe a proportional chart will have a straight line please correct me if I’m wrong :)

Graph the line with slope -1/2 passing through the point (-1,-2)

Answers

Answer:

See attachment for graph

Step-by-step explanation:

Given

[tex]m = -\frac{1}{2}[/tex]

[tex](x_1,y_1) = (-1,2)[/tex]

Required

Graph the line

First, is to determine the equation of the line using:

[tex]m = \frac{y - y_1}{x - x_1}[/tex]

So:

[tex]-\frac{1}{2} = \frac{y - 2}{x - -1}[/tex]

[tex]-\frac{1}{2} = \frac{y - 2}{x +1}[/tex]

[tex]\frac{-1}{2} = \frac{y - 2}{x +1}[/tex]

Cross multiply:

[tex](y -2) * 2 = -1 * (x + 1)[/tex]

[tex](y -2) * 2 = -x -1[/tex]

Solve for y - 2

[tex]y -2 = -\frac{x}{2} -\frac{1}{2}[/tex]

Solve for y

[tex]y = -\frac{x}{2} -\frac{1}{2} + 2[/tex]

[tex]y = -\frac{x}{2} +\frac{-1+4}{2}[/tex]

[tex]y = -\frac{x}{2} +\frac{3}{2}[/tex]

The above equation will then be plotted on the graph (See attachment)

marcus and anthony are selling camping equipment to try to earn money to buy three new gaming systems. Last month they sold backspacks for $25 a piece and surviaval kits for $29.50 a piece and made $749.50 they sold a total of 28 backpacks and survival kits. How many backpacks did they sell? How many survival kits did they sell?

Answers

Answer:

28 each

Step-by-step explanation:

+25 for backpacks

+749.50

its worth 25 please help and show work

Answers

9514 1404 393

Answer:

  3) y = √10

  4) x = 5√2

Step-by-step explanation:

The side ratios of an isosceles right triangle (one of the "special" right triangles) are ...

  1 : 1 : √2

So, for some multiplier k, they can be made to match the sides in your triangles.

__

3) 1·k : 1·k : k√2 = √5 : √5 : y

Clearly, k = √5, so ...

  y = (√5)(√2)

  y = √10

__

4) k : k : k√2 = x : x : 10

  k = 10/√2 = (5√2)/2

  k = x = (5√2)/2

Amanda runs 7 miles in 80 minutes. At the same rate, how many miles would she run in 64 minutes?

Answers

Answer:

5.6 miles

Step-by-step explanation:

[tex]\frac{7}{80} =\frac{x}{64}[/tex]   Set up the proportion

[tex]7(64)=x(80)[/tex]  Cross multiply

[tex]448=80x[/tex]     Simplify

[tex]\frac{448}{80}=\frac{80x}{80}[/tex]    Divide both sides by 80

[tex]5.6=x[/tex]

What is the Mean Absolute Deviation of the following data set?
{23, 25, 28, 29, 30}

Answers

Answer:

The mean absolute deviation is 2.4

Step-by-step explanation:

Other Questions
Find the area of the triangle. Enter your answer in the box. Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea What was the majority opinion in Plessy v Ferguson ? Halfway through the third quarter, how much of the game is left?Write the answer as a proper fraction, View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? Waldo needs to know how much force to apply in order to move a 4000-kg object at 2 m/S2. Which law should he refer to A. law of gravity B. second law C. third law D. first law PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! When McCandless is working for Wayne Westerberg in Carthage, South Dakota, Westerberg thinks that McCandlessA.is lazyB.is addicted to drugsC.is probably mentally illD.is one of the hardest workers he has ever seenE.is a genius and an artist What is correct regarding trans fatty acids Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1) hi can you please help me with my work When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough? Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2