Please help! What is the volume of the triangular pyramid?

Answer and explanation please! <3

Please Help! What Is The Volume Of The Triangular Pyramid?Answer And Explanation Please! &lt;3

Answers

Answer 1

Answer:

30cm3

Step-by-step explanation:

Volume=Base area *height

Base area is a triangle=1/2 *base*height

1/2*3*4=6cm2

Height=5cm

Volume=6*5=30cm3

Answer 2

Answer:

10 m³

Step-by-step explanation:

My apologies for attaching the explanation in a pic, brainly wouldn't let me upload my text answer for some reason.

Please Help! What Is The Volume Of The Triangular Pyramid?Answer And Explanation Please! &lt;3

Related Questions

What percent of the model is shaded green?

Answers

Answer:

1/5%

Step-by-step explanation:

The percentage of the model shaded green will be 20.

How to find how much percent 'a' is of 'b'?

Suppose a number is 'a'

Suppose another number is 'b'

We want to know how much percent of 'b' is 'a'.

Then, it is calculated as:

[tex]\dfrac{a}{b} \times 100[/tex]

(in percentage)

The total number of the box in the figure is 100.

The total number of shaded green = 20

So,

[tex]\dfrac{20}{100} \times 100[/tex]

20%

Therefore, The percentage of the model shaded green will be 20.

Learn more about percent here:

https://brainly.com/question/11549320

#SPJ2

Guys please help i dont understand im bad at math

Answers

The first on is B and the second one is C
first one is b and the other is d

Which is equivalent to the series shown?
12
Which expansion is equivalent to the summation
shown?
12
12
20 Σ
1
n=9 n=9
n +
n=9
X
1 1 1 1
20+9+10+11+12+
9 10 11 12
-
Σ (20n +
+
Ź 201n+ )
20
n
n-9
x
1
1
-
1
11
1
12
20(9 + 10 +11+12) +.
9 10
2019 +10 +1
X
1 1 1
20 9+10 +11+12+
9 10 11 12
n +
n-9
12 12
1
12 + 20
n
n=9 n-9
12 12
1
n+
n-9 n=9n
1 1 1
9+10+11+12+ 20
9 10 11 12
20Σ
COMPLETE
Na
Intro
Final

Answers

Answer:

first one is (d) second one is (b)

Step-by-step explanation:

This equation shows how the money Kensington Middle School spends on workbooks is related to the total number of workbooks they buy.d = 64.6tThe variable t represents the number of workbooks bought by the school, and the variable d represents the total cost of those workbooks. At most how many workbooks can Kensington Middle School buy if it has $64.60 to spend?

Answers

Answer:

1 workbook

Step-by-step explanation:

Equation:

d = 64.6t

Given:

d = total cost

t = number of workbooks

Work:

d = 64.6t

64.6 = 64.6t

t = 64.6/64.6

t = 1

Answer: 1 work book t=1

Step-by-step explanation:

Mikaela has saved $375 to purchase a new phone. This is of the total price of the phone. What is the price of the phone?​

Answers

Answer:

$375

Step-by-step explanation:

If she has saved $375, and the price of the phone is also $375, then the price of the phone must be $375.

5+6(2x-1)
i need this like now pls

Answers

Answer:

Step-by-step explanation:

5 + 6 = 11 x 2 - 1 = 21 therefore its 21

Find the value of x
Please help

Answers

The answer will be (B) -9 because since the angles are equal, the two sides must be equal also.
Therefore
x+16=7
And then
x= 7-16
x=-9

Answer:

b

Step-by-step explanation:

subtract 9 from 16

In order to make an A on her project, Sarah needs at least 160 points. She has already turned in part of her work and has been given 125 points so far. write and solve the inequality that models this situation and found out how many points Sarah needs for the last part of her project to get an A

Answers

A=160-125
A=35
The answer is she needs 35 more points to get her A

A class consists of 1/2 freshmen, 1/8 sophomores, and 1/8 juniors; the rest are seniors. What fraction of the class is seniors?

Answers

Answer:

2/8

Step-by-step explanation:

freshman=4/8

1/8 soph    1/8 jr

add all together u get 6/8

the rest is seniors so its 2/8

PLEASE HELP 30 cm
30 cm
76 cm
Casa wames to put a layer of sand at the bottom of the tank. The sand layer is to be 3 cm deep. If the density of sand is 2.65 9 what mass of sand does Carla need to purchase? Round to the nearest gram.
cm
6810
18. 136
25.11

cm
6810
18. 136
25.11

Answers

The mass of Sand that Carla needs to purchase for the sand tank is gotten to be; 25811 g

What is the mass required?

Formula for density is;

Density = mass/volume

From the box we are given, it's volume is;

Volume = 30 * 30 * 76

Volume = 68400 cm³

Now, from conversion;

1 cm³ = 1g. Thus;

68400 cm³ = 68400 g

Volume = Mass/density

Volume = 68400/2.65

Volume = 25811 g

Read more about mass required at; https://brainly.com/question/1762479

Pleaseeee helpp which one is it and whyyyy!!!!

Answers

Answer:

answer is A

Step-by-step explanation:

A cold water tap can fill a tub in 6 minutes, and a hot water tap can fill the tub in 8 minutes. A drain can empty a full tub in 10 minutes. If both taps are on and the drai is open, how long will it take to fill the tub? It will take
how many minutes?

Answers

Answer:

12 minutes

Step-by-step explanation:

The Hot tap fills 1/30th of the bath in 1 minute. The cold tap fills 1/20th of the bath in one minute. In one minute both taps together will fill (1/30 + 1/20) of the bath, which is 5/60ths or 1/12th of the bath. Since it takes one minute to fill 1/12th of the bath, it’ll take 12 minutes to fill the bath

Im normally good at alg ish but im confused

Answers

Answer:

The problem is telling you to find g ( f ( x ) )

Since we know that f(x) is square root of x, we can put the function this way.

g(√x)

Then, we use  √x as our x in our g(x) function.

You plug in  √x for x and you solve.

(√x ) ^2 is just x.

Finally the answer is

x-3

hope this helps :)

Step-by-step explanation:

Answer x=-3
Hope this helps!

Which of the quadratic functions has the narrowest graph?

Answers

Step-by-step explanation:

The equation with the highest leading coefficient (the number before the x^2 term) will have the narrowest graph. Here, we have to choose between -1, 1/6, 2, and 1/8. The highest number out of all of those numbers is 2, so y = 2x^2 will have the narrowest graph.

What are the abilities needed to to be good in individu the narrow

1. (20 points) One step in the manufacture of a certain metal clamp involves the drilling of four holes. In a sample of 150 clamps, the average time needed to complete this step was 72 seconds and standard deviation was 10 seconds. (a) Find a 99.5% confidence interval for the mean time needed to complete the step. (b) What is the confidence level of the interval (71, 73)? (c) How many clamps must be sampled so that 99.5% confidence interval specifies the mean to within ±1.5 seconds? (d) Can you conclude that the mean time needed to complete the step is greater than 73 seconds? i. State hypothesis. ii. Compute P-value. iii. What is your conclusion?

Answers

Answer:

(69.708 ; 74.292) ; 78% ; 350 ;

H0 : μ = 72

H0 : μ > 72

Pvalue = 0.8897

there is not enough evidence to support the claim that the mean time needed to complete the step is greater than 73.

Step-by-step explanation:

99.5% confidence level, = 2.807

Sample size, n = 150

xbar = 72

Standard deviation, s = 10

Xbar ± Margin of error

Margin of Error = Zcritical * s/sqrt(n)

Margin of Error = 2.807 * 10/sqrt(150)

Margin of Error = 2.292

Lower boundary = 72 - 2.292 = 69.708

Upper boundary = 72 + 2.292 = 74.292

(69.708 ; 74.292)

B.)

Confidence level of the interval (71, 73)

(72 - 71 ) or (73 - 72)

Margin of Error = 1

Margin of Error = Zcritical * s/sqrt(n)

1 = Zcritical * 10/sqrt(150)

1 = Zcritical * 0.8164965

Zcritical = 1 / 0.8164965

Zcritical = 1.2247

α = 0.22 = 1 - 0.22 = 0.78 = 78%

C.)

Margin of Error = ±1.5

1.5 = Zcritical * s/sqrt(n)

99.5% confidence level, = 2.807

1.5 = 2.807 * 10/sqrt(n)

1.5 = 28.07 / sqrt(n)

Square both sides

1.5² = 28.08² / n

2.25n = 788.4864

n = 788.4864 / 2.25

n = 350.4384

n = 350 samples

D.)

H0 : μ = 72

H0 : μ > 72

Test statistic :

(xbar - μ) ÷ s/sqrt(n)

(73 - 72) ÷ 10/sqrt(150)

Test statistic = 1.2247

Pvalue :

P(Z < 1.2247) = 0.8897

Pvalue > α

0.8897 > 0.005

We fail to reject the Null ; Hence there is not enough evidence to support the claim that the mean time needed to complete the step is greater than 73.

If the die is rolled 24 times, Find the experimental probability of rolling a 5. Simplify!

Answers

Answer:

gay

Step-by-step explanation:

Neal's room has sides 10 1/4 ft and 12 5/6 ft. What is the perimeter?

Answers

Answer:

66 1/6ft

Step-by-step explanation:

I have calculated by saying perimeter =2(length+width). I think that's the answer hope it helps.

Answer: 46 1/4

Step-by-step explanation:

Perimeter = (L+W) x 2

So basically ... (10 1/4 + 12 5/6) x 2

Which would be ...  23 1/12 x 2

Which gives you the answer of 46 and 1/4

john takes a small business loan
for $18,000. the term for
repayment is 60 months and
the annual interest rate is 5.25%.
using the monthly payment
formula, what is the estimated
monthly payment?

Answers

9514 1404 393

Answer:

  $341.75

Step-by-step explanation:

You have not provided the formula, so we'll use one we like:

  A = P(r/12)/(1 -(1 +r/12)^(-n)) . . . . principal P, annual rate r, n months

  A = $18,000(0.0525/12)/(1 -(1 +0.0525/12)^-60) ≈ $341.75

The monthly payment is about $341.75.

0. Folded boxes a. Squares with sides of length x are cut out of each corner of a rectangular piece of cardboard measuring 5 ft by 8 ft. The resulting piece of cardboard is then folded into a box without a lid. Find the volume of the largest box that can be formed in this way. b. Squares with sides of length x are cut out of each corner of a square piece of cardboard with sides of length /. Find the volume of the largest open box that can be formed in this way.

Answers

Answer:

Box dimensions:

L = 3 ft

D = 6 ft

H = 1 ft

Volume  V = 18 ft³

Step-by-step explanation:

a) Each side of the future box is

L = 5 - 2*x     D = 8 - 2*x  

height of the box is   x

Then the volume of the box as function of x is:

V(x) =  ( 5 - 2*x ) * ( 8  - 2*x ) * x

V(x) = ( 40 - 10*x - 16*x + 4*x² ) * x

V(x) = 40*x - 26*x² + 4*x³

Tacking derivatives on both sides of the equation:

V´(x) = 40 - 52*x + 12x²     or     V´(x) = 20 - 26*x + 6*x²

If V´(x) = 0

6*x² - 26*x + 20  = 0

Solving for x

x₁,₂  = (-b ± √ b² - 4*a*c  ] /2*a

x₁,₂  = ( 26  ±  √ 676  - 480  ) / 12

x₁,₂  =  (26 ± 14 )/ 12

x₁  = 1

x₂ = 3,33        ( we dismiss this solution since is not feasible according to cardboard dimensions )

Then the sides of the box are:

L = 5 -2*x      L  =  5 - 2*1     L = 3 ft

D = 8 - 2*x    D  = 8 - 2*1     D = 6 ft

H = x = 1 ft

And the volume is    V = 6*3*1 = 18 ft³

A company that makes​ hair-care products had 4,000 people try a new shampoo. Of the 4,000 ​people, 16 had a mild allergic reaction. What percent of the people had a mild allergic​ reaction?

Answers

Answer:

0.4% or in decimal form 0.004

Step-by-step explanation:

took the test and got it right!

No scams. Show your work. write answer as a percent and round the nearest whole number if needed.​

Answers

Answer:

Step-by-step explanation:

we will find the area of the inner circle and then the area of the outer circle and see what the ratio is between those 2

area of a circle = [tex]\pi[/tex][tex]r^{2}[/tex]  (where r is the radius, NOT the diameter, easy to confuse)

the radius of the inner circle is 2.5. which  is half of the diameter of 5

inner circle = [tex]\pi[/tex]*(2.5)^2

inner circle =  19.6349...

outer circle = [tex]\pi[/tex]*(10^2)

outer circle = 314.1592...

the ratio is    19.6349... /  314.1592...  = 0.0625

0.0625 = 6.25%

= 6% ( rounded to nearest whole number )

I'm unsure how to solve for w, can someone please help?

Answers

Answer:

w = 1/2

Step-by-step explanation:

One of the ways to solve problems using log is to use these two equations that use the same variables and plug in numbers.

log b (a) = c

b^c = a

By plugging in the numbers we get this:

log 16 (4) = w

16^w = 4

w = 1/2

Jane drew a marble at random from a bag containing 4 blue, 6 red, and 10 point
5 green marbles. She drew from the bag 30 times, Here are the results of
her draw: 12 reds, 10 greens, and 9 blue. What is the experimental
probability that she will draw a green in her next draw? *

Answers

Answer: the chances are 5 out of 15 so in 30 draws she would draw 10 green hope it helps

Jarrod helped his teachers pack textbooks into boxes for the summer. He packed 6 boxes of science textbooks with 14 books per box. He also packed math textbooks with 12 books per box.

If x represents the total number of boxes he packed, which of the following equations can be used to find the total number of books that Jarrod packed into boxes?
A. y = 84(x - 6) + 12
B. y = 12x + 84
C. y = 84x + 12
D. y = 12(x - 6) + 84

Answers

Answer:

Step-by-step explanation:

Answer:

Biy.com/5698

Any help would be appreciated

Answers

Answer:

$8.25

Step-by-step explanation:

I don't know how to explain it to you but if I'm wrong tell me I'll try it aagain.

10
TIME REMAININ
58:05
The point plotted on the number line is a
5
What is the approximate value of x?
4
9
17
20

Answers

Answer:

17

Step-by-step explanation:

[tex]\sqrt{x} = 4.1[/tex]

16 is close to 4^2. Only other viable option is 17. GL ON UR TEST :D

I’ll give points + brainslist, if you don’t know don’t bother answering (:

Answers

C. 35 because c. Is the right answer just trust me ok

Please help me I'm really struggling.

Answers

Answer:

eight chairs.

Step-by-step explanation:

five quarts= 40/8 quarts

one chair= 5/8 quarts

40/8-5/8x=0

(-40/8)/(-5/8)=x

eight chairs

1/3 of 36 solve using a tape diagram

Answers

That would be 12! I’m not sure what a tape diagram is but the answer is that. 1/3 * 36= 12

Find the area of the polygon to the nearest square inch.

Answers

Answer:

137 in.^2

Step-by-step explanation:

A = nsa/2

where

n = number of sides = 9

s = length of side = 4.7 in.

a = length of apothem = 6.5 in.

A = (9)(4.7 in.)(6.5 in.)/2

A = 137.475 in.^2

Answer: 137 in.^2

Other Questions
A democracy that adopts simple plurality or first past the post electoral rules is likely to have a Group of answer choicesTwo-Party System.Multi-Party System.One Party System. A phase change is when a substance changes from one state of mind to nother because of the adding or removal of thermal energyTrueFalse pleaase help withhh tthis used to have a square garage with 296 ft of floor space. recently built an addition to it. The garage is still a square, but now it has 50% more floor space. What was the length of one side of the garage originally? What is the length of one side of the garage now? What was the percent increase in the length of one side? Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants?