Please I need help with this

Please I Need Help With This

Answers

Answer 1
TAAGCCGATAAATGCTAACGGTA

Related Questions

describe classification as a work in progress discuss the characteristics of the three domains: Bacteria, Archaea, and Eukarya describe classification by cladistics summarize how molecular evidence reveals species relatedness identify the structures and shapes of viruses describe different types of viral infections

Answers

Answer:

Bacteria, Archaea, and Eukarya represent the three domains of life by which all living organisms are classified. This type of classification was coined by Carl Woese et al. (1990). Archaea and Bacteria represent different domains because Archaea is considered to have the evolutionary oldest phenotypic features, while Bacteria species have diacyl glycerol diester lipids in their membranes. On the other hand, the Eucarya domain is composed of organisms that possess a nuclear envelope (membrane).  

Cladistics is a biological method used to classify organisms into groups named 'clades'. In this type of classification, organisms are categorized according to the most recent common ancestor. In this regard, it is possible to find the most recent common ancestor by using nucleotide differences between taxa.

Viruses can be classified in a similar manner to the cellular organisms above described. Viruses are categorized according to morphological features, type of nucleic acid (DNA or RNA) by which they are composed, mode of replication, host organisms, etc. Viruses may also be classified according to the type of disease that they cause. There are viruses that cause chickenpox, rabies, influenza, old sores, Ebola, AIDS (HIV), Severe acute respiratory syndromes (SARS), etc.

Describe classification as a work in progress

Since it reflects the most current understanding of how living things are related, new discoveries can change the way living things are classified also something is always changing.

Discuss the characteristics of the three domains: Bacteria, Archaea, and Eukarya

Bacteria includes common bacteria, Eukarya includes the four kingdoms: plants, animals, fungi, and protists. Archaea includes some of the oldest organisms on the planet.

Describe classification by cladistics

Cladistics depict hypothesis about how organisms are related based n their ancestors and descendants.

Summarize how molecular evidence reveals species relatedness

they are classified by DNA now instead of physical features.

Identify the structures and shapes of viruses

the shape can be helical,envelope,icosahedral,complex.

Describe different types of viral infections

lytic infection: virus enters the host cell, replicates copies, and destroys the cell to get out and spread to others/ Lysogenic infection: virus incorporates its DNA into the DNA of the cell. They both attach to host cells and use the cells resources to replicate genetic materials and parts.

what are the problems and the challenges in classifying living things​

Answers

Answer:

below

Explanation:

there are so many different kinds of living things that its so difficult to classify them as there would be too many classifications that it would become absurd to have only a few organsims in a single group. the role of classification is to organize as well as simplify so it proves to be a challenge when the subgroups branching from eukoryotes vs prokaryotes become too small and therefore it becomes a giant mess.  even the current classification system (taxonomy) is flawed.

The problems/challenges associated with classifying living things is : The challenge of having a very small number of living thing classified into a subgroup and having an enormous amount of subgroups.

Although the main reason of classification of organism is to organize/categorize every living thing into a suitable group as well as simplify the subgroups( this leads to having a lot of subgroups ). there is also a challenge whereby the subgroups become so small when trying to categorize every organisms following all the rules of taxonomy. while

Taxonomy is the science of classifying living things into different groups and subgroups following certain similar characteristics exhibited by the organism.

An example is : The subgroups of eukaryotes vs prokaryotes becoming  too small. because the rules of Taxonomy been followed.

hence the challenges are: very small number of living thing classified into a subgroup and having an enormous amount of subgroups.

learn more : https://brainly.com/question/1845332

How are surface waves different from body waves? Which are more damaging?

Answers

Answer:

Explanation:

surface waves decay more slowly with distance than body waves, which travel in three dimensions. Particle motion of surface waves is larger than that of body waves, so surface waves tend to cause more damage.

Answer:

surface waves decay more slowly with distance than body waves, which travel in three dimensions. The particle motion of surface waves is larger than that of body waves, so surface waves tend to cause more damage. Surface waves. Their side-to-side motion (like a snake wriggling) causes the ground to twist from side to side, that's why Love waves cause the most damage to structures. Rayleigh waves create a rolling, up, and down motion with an elliptical and retrograde particle motion confined to the vertical plane in the direction of propagation.

Explanation:

When CFCs are exposed to high levels of UV radiation, what occurs? A. The compound breaks down into nitric oxide and ozone. B. All of these C. A chlorine breaks off and forms a free radical. D. They become ionized and stick together in clumps that become part of smog.

Answers

Answer:

C. A chlorine breaks off and forms a free radical

Explanation:

When CFCs are exposed to high levels of UV radiation in the atmosphere, the CFC molecule breaks into chlorine and forms free radicals.

These free chlorine radicals then reacts with ozone molecules and breaks the ozone atom (O3) to form chlorine monoxide and oxygen (O2) molecule.

CFCs are main cause of ozone depletion in the atmosphere.

Hence, the correct option is "C".

In a cladogram (a type of phylogenetic tree), clades are groups of related organisms. In the past, phylogenetic lists built clades using the idea of parsimony, that the pattern that uses the fewest evolutionary changes is the most likely to be correct. Today, with the use of computers and DNA sequences, the explanation that is thought to be the best is ___________ .

Answers

Answer:

one with the fewest number of genetic differences in the nucleotide sequence.

Explanation:

A cladogram is a diagram capable of showing the relationships among different species and/or group of organisms. In a cladogram, the root indicates the common ancestor, while internal nodes represent the common ancestors of each group. In consequence, this diagram can be used to establish evolutionary relationships in which the start branch points represent common ancestors shared by the organisms found in the 'branches'. Nonetheless, the length of the branches in the cladogram does not represent evolutionary distances among groups. In recent years, cladograms based on DNA sequencing data have been combined with morphological data to establish evolutionary relationships among species.

Please help!

A. summer
B. autumn
C. winter
D. spring

Answers

Summer is about to begin the hemisphere



Your welcome

ANSWER FAST Which statement about cell theory is INCORRECT? New cells are spontaneously created from existing cells. All organisms are composed of one or more cells. Cells are the basic unit of life and structure. New cells are created from existing cells.

Answers

New cells are spontaneously created from existing cells

In the first 10 weeks of a resistance training program, the gains in strength are due primarily to Group of answer choices neural adaptations hypertrophy hyperplasia increased muscle fiber size

Answers

Answer:

The correct answer is A: Neural Adaptations  

Explanation:

From zero to ten weeks of starting a resistance training program, the above gains in strength happen as a result of Neural Adaptations

Strength training helps improve and increase the motor neuron pathways that strengthen the coordination between the brain and the body of the athletes during repetitive motion.

Cheers!

Uracil pairs with
O any nitrogen base
O uracil.
O adenine.
O thymine.

Answers

Answer: adenine

Explanation:

Which of the following is not a function of the cell membrane? A. Keeping all the parts of a cell inside B. Helping a cell to alter its shape C. Allow prokaryotes to use cell division D. A place for cellular reactions to take place

Answers

Answer:

D. A place for cellular reactions to take place

Explanation:

the cell membrane perfomes divers functions ranging from the  Keeping of all the parts of a cell inside, helping cell to alter its shape, allowing prokaryotes to use cell division. Most of the cell reactions happens in the Mitochondrion, not the CELL MEMBRANE

A place for cellular reactions to take place is not true about cell membrane .

What are the function of cell membrane ?

Cell membrane forms barrier keeping the constituents of the cell in and unwanted substances out and to be a gate allowing transport into the cell of essential nutrients and movement from the cell of waste products.

What is cell membrane?

The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment.

Hence, D is correct option

To learn more about cell membrane, here

https://brainly.com/question/18478861?referrer=searchResults

#SPJ2

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Cells that secrete a lot of substances via active transport need a lot of ___in their cytoplasm.
А)endoplasmic reticulum
B)mitochondria
С)golgi apparatus
D)lysosomes
E)chromosomes

Answers

Answer:

The correct answer is lysosomes.

Explanation:

Cells that secrete a lot of substances via active transport need a lot of lysosomes in their cytoplasm.

Hope this helps....

Be Brainly!!

Have a nice day!!!!

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

Which statement describes an interaction between the biosphere and the atmosphere that is related to photosynthesis? During photosynthesis, plant roots take in water from soil. During photosynthesis, plants take in carbon dioxide from the air. Through photosynthesis, energy stored in plants is released into the air. Through photosynthesis, energy stored in plants is transferred to humans who eat them

Answers

Answer:

Option B on edge 2020

Explanation:

The correct statement that relates the interaction between the biosphere and atmosphere during photosynthesis is ; ( B )

During photosynthesis, plants take in carbon dioxide from the air ( B )

Photosynthesis is process whereby plants and algae ( green ) make use of sunlight and water in the presence of carbon dioxide obtained from the atmosphere to create their food while giving out oxygen back to the atmosphere.

Energy stored/created in plants are not released to animals through the air but  Carbon dioxide present in the atmosphere is take into the biosphere by plants during photosynthesis.

Hence we can conclude that During photosynthesis plants take in carbon dioxide from the air .

Learn more : https://brainly.com/question/9498584

what are general characteristics of algae ?​

Answers

Answer:

1. it has not defined length..

2. it digest good in food vacoule

hlo

can we talk in comment section

Most algae are photoautotrophic and carry on photosynthesis.

Reproduction in algae occurs in both asexual and sexual forms.

During sexual reproduction, algae form differentiated sex cells that fuse to produce a diploid zygote with two sets of chromosomes.

What protective items should you wear when using benedicts solution?

Answers

Answer:

Hey there!

You should wear gloves and safety goggles when using benedicts solution.

Let me know if this helps :)

A(n) _______
is a special type of scientific investigation
that is performed under controlled conditions typically
including a dependent and independent variable.

Answers

Answer:

experiment

Explanation:

When you are controlling the conditions it is called an experiment.

An experiment is a special type of scientific investigation that is performed under controlled conditions typically including a dependent and independent variable.

What is scientific investigations?

A scientific investigation is a strategy for posing questions as well as testing potential responses.

Anecdotes are usually the starting point for a scientific investigation. Observations frequently generate questions.

Based on scientific knowledge, a hypothesis is a possible logical answer to a scientific question.

The goals of scientific research are to generate knowledge and provide explanations.

Science investigations are carried out in a variety of settings and by a wide range of individuals. Scientific investigations are carried out in a variety of ways that focus primarily on the collection of various types of evidence.

Thus, an experiment is a sort of scientific investigation which takes place under lab settings and generally involves a dependent as well as independent variable.

For more details regarding scientific investigations, visit:

https://brainly.com/question/8386821

#SPJ2

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.

Answers

Complete Question:

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.      

Tree-dwelling primates have prehensile tails for gripping branches. Tree-dwelling opossums also have prehensile tails.  Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues.    Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.  Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live. Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.

Answer and Explanation:

Tree-dwelling primates have prehensile tails for gripping branches.  Considering recent ancestors, the prehensile tail trait can be considered as a convergence example that occurred among different groups. But we can also think about it as a common descent if we consider the farthest primates ancestor. Although still controversial, Plesidiapsi might be considered a common ancestor of primates, that evolved from a ree-dwelling mammal with a long tail. It is believed that this animal used to live in trees.   Tree-dwelling opossums also have prehensile tails.   Convergence. Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues. Convergence. These are two groups that are very separated from each other, and they developed different traits according to their needs separately. Some of the species of these two groups adapted to feed on the same plant so they needed to develop the same characteristic to obtain nectar.Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.   Common descent . The common ancestor had a prehensile tail, some of the descendants developed the tail but some others did not.Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live.  Common descent . Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.  Common descent . They all look like the finch-like ancestor.

what is which sphere

Answers

Answer:

frog is the best answer

Describe how fossils provide evidence of evolution

Answers

Answer:

Fossils provide solid evidence that organisms from the past are not the same as those found today; fossils show a progression of evolution. Fossils, along with the comparative anatomy of present-day organisms, constitute the morphological, or anatomical, record. By comparing the anatomies of both modern and extinct species, paleontologists can infer the lineages of those species. This approach is most successful for organisms that had hard body parts, such as shells, bones or teeth. The resulting fossil record tells the story of the past and shows the evolution of form over millions of years.

Explanation:

HOPE IT HELPS.PLEASE MARK IT AS BRAINLIEST

Answer:

fossils are the preserved remains or traces of animals , plants and other organisms from the past fossils range in age from 10 000 to 3.48 billion years old. the observation that certain rock strata led 19th centuary geologist to recorgnise a geological timescale.

Discuss how the idea of vertical farming reflects the role of science in society.

Answers

Answer:

average global food prices have gone up by 2.6 percent annually in the past two decades. if that trend continues , not only does it threaten a baseline quality of life as more disposable income goes toward.

Vertical farming is the practice of growing local crops like fruits and vegetables with minimal resources by using high technological methods in a controlled environment.

Why vertical farming is important?

It has been said to be the future of agriculture in the UAE since they huge amount of goods and have to find ways to be self sustaining by boosting local production. Apart from being self sustaining, they also aim to provide safe and nutritious food.

The vertical garden is an agriculture concept for growing plants inside buildings or multi-story skyscrapers, often called farmscrapers, a term derived from the English skyscraper. In these buildings, which would function as large greenhouses, agriculture involves the use of technologies such as hydroponics to aid in plant growth. Some projects include the practice of livestock (especially poultry) on the lower floors.

Therefore, Vertical farming is the practice of growing local crops like fruits and vegetables with minimal resources by using high technological methods in a controlled environment.

Learn more about Vertical farming on:

brainly.com/question/2063033

#SPJ5

Which component of physical fitness is skill related? A.Flexibility B.cardiorespiratory C.muscular strength D.agility

Answers

Answer:

D.agility

Explanation:

D.agility

Answer:

D Agility

Explanation:

physical fitness components related to skills, including: explosive power, speed, agility, coordination, speed, reaction and balance.

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

3. Which plants are usually the first to grow during secondary succession?
A ferns
Blichens
Cweeds
D trees

Answers

Answer:

ferns

Explanation:

these are alsi known as conifers which require a great amount if light

Im not a science student just trying beans I guess

Find the weight of a pine tree that has a circumference of 14 inches and a height of 120 feet. Use the equation: W = b0 + b1(D2H)

Answers

Answer:

The answer is below

Explanation:

The weight of trees is calculated using the equation:

[tex]W=b_o+b_1(D^2H)[/tex]

Where W is the weight in tons, [tex]b_o \ and\ b_1[/tex] are constants , D is the diameter of the tree in inches and H s]is the height of the tree in feet.

The circumference = 14 inches. But circumference = 2πr, where r is the radius and π = 22/7. Therefore:

14 = 2(22/7)× r

14 = (44/7)×r

r= 14 × 7 / 44 = 2.23 inches

Diameter = 2r = 4.45 inches

[tex]W=b_o+b_1(4.45^2*120)\\W = b_o+2381b_1\\Let\ us\ assume\ b_o = -34.671,b_1=1.859.\\Therefore\\W = -34.671+2381(1.859)\\W=4392 \ tons[/tex]

Which of the following is a testable hypothesis?
a. Roses are more beautiful than violets.
b. A plant needs at least five hours of sunlight per day to grow.
c. I've cream is delicious.
d. Humans will someday land on Mars.

Answers

B is the correct answer because none of this that you put are testable.

Answer:

B. because it's something u can actually do it,  and it's more reasonable

Explanation:

an example for a hypothesis could be, If a gets at least 5 hours of sunlight per day, then it will grow. I hope this helps you :)

Raman’s teacher taught about changes that take place during Adolescence

period in the class today. Which of the following change take place in girls

during Adolescence period?

a) Increase in breast size b) Menstruation

c) Growth of hair in genital area d) All of the above​

Answers

Answer:

d) All of the above​

Explanation:

Adolescence is the period which is following the onset of puberty in a young person and turns them into an adult.

During adolescence, both males and females undergo several physical changes. Some of the physical changes in the girls' or female's body include increase in breast size, menstruation, and growth of genital hair.

Hence, the correct answer is "d".

Electrical stimulation of the brain (ESB) is a technique in which a charged current is passed through a(n) __________ that is implanted in the brain.

Answers

Answer:

electrode

Explanation:

Electrical stimulation of the brain (ESB) is a relatively new technique used to treat chronic pain and tremors associated with Parkinson disease. ESB is administered by passing an electrical current through an electrode implanted in the brain.

What would happen if sex cells were diploid?
A. They would require 2 other gametes to fuse with.
B. When they fused, the resulting embryo would have double the amount of DNA it should
have.
C. When they fused, the resulting embryo would have half the amount of DNA it should
have.
D. Sex cells are diploid.

Answers

If the gametes will be diploid then on fusing the resulting embryo would have double the amount of DNA it should have. The correct option is B.

What are gametes?

A gamete is an animal or plant procreative cell. Female gametes are known as ova or egg cells in animals, while male gametes are known as sperm.

Ova and sperm are haploid cells, with only one copy of each chromosome in each cell. A sperm and an ovum combine during fertilization to form a new diploid organism.

As in case of diploid gamete, the embryo will have double amount of DNA than normal and will create defect.

Thus, the correct option is B.

For more details regarding gametes, visit:

https://brainly.com/question/2569962

#SPJ2

A group of coordinately regulated structural genes with related metabolic functions, plus the promoter and operator sites that control their transcription, is called a/an ___________.

Answers

Answer:

They are called promoter and regulatory genes.

Explanation:

There are different genes responsible for regulating transcription:

These are the inhibitors, promoters and regulators.

Regulatory genes are in charge of regulating that promoter or inhibitor genes remain intact or do not present mutations.

Promoter genes promote cell replication, hence transcription.

In the case of malignant or benign neoplasms, there must be yes or if the affection of a regulatory gene plus the affection of an inhibitory or promoter gene.

Other Questions
a Find the amount compounded annually on Rs 25,000 for 2 years if the rates ofinterest for two years ore 10 % and 12 % respectively, A local restaurant offers an "all you can eat" Sunday brunch for $12. Susan eats four servings, but leaves half of a fifth helping uneaten. Why Gideon Company uses the direct write-off method of accounting for uncollectible accounts. On May 3, the Gideon Company wrote off the $2,000 uncollectible account of its customer, A. Hopkins. The entry or entries Gideon makes to record the write off of the account on May 3 is Suppose Real GDP is $700 billion and Natural Real GDP is $620 billion. To eliminate this ________________gap, Keynesian theory indicates that government should ______________________. In terms of formal powers in the realm of foreign policy, ________ Group of answer choices Congress is entirely in charge the president is entirely in charge the president and Congress share power decisions are delegated to experts in the bureaucracy The K sp for silver(I) phosphate is 1.8 10 18. Determine the silver ion concentration in a saturated solution of silver(I) phosphate. please help. pls show workings Y = 0.2(0.35)^t decay rate the length of a basketball pitch can be divided into 12 parts which 25 centimetres on how much parts it's 20 centimetres long can be obtained from the pitch What can you learn about the pH of a substance with the conductivity test? hint: gives you no info on concentration. The Venn diagram shows 3 type numbers odd even in prime Find the missing probability: P(B)=7/20, P(A|B)=1/4, P(AB)=? Given the equation 4x8y=32, a second equation that forms a system with no solution is: 1. x2y=8 2. x2y=32 3. x+2y=8 4. 2xy=32 67.77759 rounded to nearest meter What are some advantages of James Hurst deciding to have Brother as the narrator? (answer in 3-5 well-developed sentences) * Sophie is experiencing so much guilt associated with the death of her boyfriend that it is beginning to interfere in every aspect of her life. She is probably experiencing: Group of answer choices Which object forms when a supergiant explodes? a red giant a black hole a white dwarf a neutron star Allowing a candidate's high score on an interview to make up for a low score on a personality test is an example of the A company purchased property for a building site. The costs associated with the property were: What portion of these costs should be allocated to the cost of the land and what portion should be allocated to the cost of the new building? Enter the following transactions in the cash book of Sudhir & sons