Please
help
with
this

Pleasehelpwiththis

Answers

Answer 1
Scale factor = 5:84

14 ft = 14 × 12 = 168 in
10 ÷ 2 = 5
168 ÷ 2 = 84
10:168 ratio simplified is 5:84

Related Questions

Given the Latin root harmos, meaning “joint” or “shoulder,” which word in bold means “to make fit together”?

The effect of the sun is quite harmful to human skin.

The hapless driver suffered two flat tires in one day.

The goal to harness the power of the sun to create electricity was very ambitious.

We were asked to harmonize our efforts so the process would work more smoothly.

Answers

Harmonize is the answer
I did a lot in this one ☝️

What is a periodic report?​

Answers

Answer:

Periodic Report is a feature that periodically summarizes app data and logs the summarized result. The feature summarizes app data hourly, daily, monthly, or at certain intervals, and then logs the result.

thats ur answer<3 have a great day!

Answer:

Periodic Report is a feature that periodically summarizes app data and logs the summarized result. The feature summarizes app data hourly, daily, monthly, or at certain intervals, and then logs the result.

Explanation:

we would still be closely connected to our food

Answers

Answer:

Lol sure But you got banlance your apatype

Explanation:

Pay It Off!
Let's say you have $1,000 in savings and are making 6
percent interest. That means that you make $60 a month
in interest. Let's also say that you have $500 you need to
pay off on your credit card. By not paying it off, they charge
you 18 percent interest a month. That means you owe an
extra $90 a month! It's just foolish to keep putting money
in a savings account when you have credit cards to pay off.
You'll save money if you pay off the credit cards and then
start saving
Save It!
I don't know why people don't try to save more. Now, it's
smart to go ahead and work on paying off any debt you
currently have on credit cards. But, it's even better to stop
using your credit cards! Instead of constantly buying
things on credit cards, put your money in a savings
account and wait until you have the cash to buy what you
want. That way you won't end up losing all your money to
credit card debt! Try to stop spending and start saving.
What is a common main idea from both of these texts?
A. It's important to pay off debt.
O B. You should never pay off debt.
C. It's a good idea to open a savings account.
D. You should always save.

Answers

Answer:

I think the main idea is A because they keep on talking about paying off debt and how it is foolish to do stuff if you haven't payed off debt.

Double quotation marks are used:
1) whenever there is direct quotation
2) for internal dialogues​

Answers

Answer:

1) whenever there is a direct quotation

Whenever there is a direct quotation

please help marking brainliest​

Answers

Answer:

What is the question????

Answer:

The answer is A

Explanation:


12/ A kitten is _______ than a puppy.

A- cuter

B- more cuter

C- most cuter

D- cute


13/ This is the ______ book in the store.

A- worse

B- most bad

C- baddest

D- worst


14/ A cat is _________ than a lion.

A- weaker

B- weakest

C- more weak

D- more weaker


15/ That was the __________ exam I had all semester.

A- more difficult

B- difficultest

C- most difficult

D- most difficultest


16/ Some sports are ________ than others.

A- more excite

B- most exciting

C- more exciting

D- excitinger


17/ Water is _______ than Soda.

A- healthier

B- more healthier

C- most healthy

D- healthiest

Answers

Comparison is used to indicate the differences between people and objects. The comparative words that fit into the sentences have been indicated below;

12/ A kitten is cuter than a puppy.13/ This is the worst book in the store.14/ A cat is weaker than a lion.15/ That was the most difficult exam I had all semester. 16/ Some sports are more exciting than others.17/ Water is healthier than Soda.

So, given the sentences above, there are the first degree, second degree, and third-degree levels of comparisons.

The third degree level is used in comparisons that involves three or more items whereas, the second degree level of comparison is used to compare two things.

Learn more here:

https://brainly.com/question/1404938

Surely she was near the cabins now, Sam thought. Even as she saw the
storm clouds headed her way, she hiked on up the mountain. She
could set up her tent here, she knew, and wait out the approaching
storm. It was getting closer, and it would be so much easier to set up
the tent now while the weather was still dry. But it would be so much
more comfortable if she could just get to the cabin first. More than
anything, she just wanted to sleep in a real bed tonight. As the first
drops of rain began to fall, Sam stopped. She struggled to set up the
tent as the wind whipped around her.

Answers

Answer:

The correct answer would be D because she wanted to sleep in a real bed and continue hiking, making her forced to set up her tent in the middle of the storm with high winds. Hope this helps!

Sam's desire to sleep in the cabin means that she had to face setting up camp in the middle of the storm is best explains Sam's motivation, to lead to the conflict in the story.

How does motivation relate to conflict?

Sometimes the desire to do something deserving, decent, or enjoyable is thwarted by the reality that it requires discomfort, trouble, or effort. The organism is then torn between two diametrically opposed goals. An approach/avoidance conflict is one type of motivational conflict.

Thus, option D is correct.

For more details about motivation relate to conflict, click here:

https://brainly.com/question/21998554

#SPJ2

Find three ratlos equivalent to the ratio described in the situation
The ratio of cups of water to cups of milk in a recipe is 1 to 4
Three equivalent ratlos are 2 to
3 to
4 to

Answers

Answer:

2 to 8

3 to 12

4 to 16

Explanation:

Ratio of cups of water to cups of milk = 1 to 4 = 1 : 4

Thus, three equivalent ratios of the situation described above will be:

✔️Since 1 cup of water is to 4 cups of milk (¼) therefore:

2 cups of water will require x cups of milk (²/x)

Thus:

¼ = ²/x

Cross multiply

x = 4*2

x = 8

Equivalent ratio: 2 to 8

✔️Since 1 cup of water is to 4 cups of milk (¼) therefore:

3 cups of water will require x cups of milk (³/x)

Thus:

¼ = ³/x

Cross multiply

x = 4*3

x = 12

Equivalent ratio: 3 to 12

✔️Since 1 cup of water is to 4 cups of milk (¼) therefore:

4 cups of water will require x cups of milk (⁴/x)

Thus:

¼ = ⁴/x

Cross multiply

x = 4*4

x = 16

Equivalent ratio: 4 to 12

which lines in this excerpt from act 1 scene v11 of macbeth imply that macbeth considered duncan a good man​

Answers

Answer:

Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against

Explanation:

William Shakespeare's "Macbeth" revolves around the story of how Macbeth propels himself to be the King of Scotland. But despite being king, he would also bring about his downfall in the end.

Act I scene vii of the play reveals Macbeth's reluctance, at some point, about killing Duncan. But if he did not do that, then the throne will not be his. So, pressurized by his wife, he did the deed of killing Duncan and putting the blame on the chamberlains.

But, the opening scene shows Macbeth revealing his true opinion of the King. He admits "Besides, this Duncan

Hath borne his faculties so meek, hath been

So clear in his great office, that his virtues

Will plead like angels, trumpet-tongued, against".

These lines reveal how Macbeth considered Duncan to be a good man, whose virtues will speak for him even in the afterlife.

how does banquo react to the attack

Answers

Answer:

i think he laughs i don't know im pretty sure im right tho

A business with two locations buys seven large
delivery vans and five small delivery vans. Location A
receives 5 large vans and 2 small vans for a total cost
of $235,000. Location B receives 2 large vans and 3
small vans for a total cost of $160,000. What is the
cost of each type of van? Use x for the price of a large
van and y for the price of a small van.

Answers

Answer: price of a large van = $35000

price of a small van = $30000

Explanation:

Let the price of a large van = x

Let the price of a small van = y

Since A receives 5 large vans and 2 small vans for a total cost of $235,000. Location B receives 2 large vans and 3

small vans for a total cost of $160,000. This can be written as:

5x + 2y = 235000 ........ i

2x + 3y = 160000 ........ ii

Multiply equation i by 2

Multiply equation ii by 5

10x + 4y = 470000 ..... iii

10x + 15y = 800000 ..... iv

Subtract iii from iv

11y = 330,000

y = 330000/11.

y = 30,000

From equation I,

5x + 2y = 235000

5x + 2(30000) = 235000

5x + 60000 = 235000

5x = 235000 - 60000

5x = 175000

x = 175000 / 5

x = 35000

Therefore, price of a large van = 35000

price of a small van = 30000

The price of a large van, x and price of a small van, y is $35,000 and $30,000 respectively

Given:

large van = x

small van = y

Location A

5x + 2y = 235,000

Location B:

2x + 3y = 160,000

5x + 2y = 235,000 (1)

5x + 2y = 235,000 (1)2x + 3y = 160,000 (2)

multiply (1) by 3 and (2) by 2

15x + 6y = 705,000 (3)

4x + 6y = 320,000 (4)

subtract (4) from (3)

15x - 4x = 705,000 - 320,000

11x = 385,000

x = 385,000 / 11

x = 35,000

substitute x into (2)

2x + 3y = 160,000

2(35,000) + 3y = 160,000

70,000 + 3y = 160,000

3y = 160,000 - 70,000

3y = 90,000

y = 90,000 / 3

y = 30,000

Therefore, the price of a large van, x and price of a small van, y is $35,000 and $30,000 respectively.

Learn more about equation here:

https://brainly.com/question/15165519

Which of the following is an unsubstantiated opinion from the selection?
Jordan played on two olympic basketball teams.
Jordan was the first 40-year-old to earn 43 points in an NBA game.
Jordan led his team to its first NBA championship.
Jordan had the most recognizable face in the world in the 1990s.

Answers

Answer:

THE NDL

shhhh

Explanation:

ur welcome

Answer:

last one

Explanation:

What does the suffix -ize mean?

full of

the action of

make

capable of being

Answers

Answer:

make

Explanation:

the answer is up at the top.

How does priestly present mr Birling as a selfish character ?

Answers

One instance of selfishness is with the Birling family, who appear to live in their own “comfortable” bubble of wealth and avarice, which inhibits and warps their views of the world. For instance, the stage directions describe the “suburban” Birling family home as “pink and intimate”. The use of the adjective “pink” connotes ‘rose tinted spectacles’; the sense that the Birling family has a nostalgic, anachronistic and out-of-touch perception of the world, implying they are detached from the realities of modern Britain. This feeling is further augmented when the Inspector arrives and shatters their rapacious ignorance. The lighting changes drastically, going to “brighter and harder”. The implication of such a change is that the Inspector is shining a light (as though in a police interrogation) on areas the Birlings had never previously seen (because of the ignorance afforded to them by their greed and selfishness).

Hope this helps! x

The drawing of the $1 bill is important to this passage because it
A. shows why a fake $1 bill is hard to spot
B. gives an example of a fake $1 bill
c. gives extra information about the Great Seal
D. tells about the people who designed the Great Seal

Answers

Answer:

Explanation:

Tells us about people who designed the great seal

Where is fallacious reasoning most often found?
in newscasts, articles, movies, television shows, and political speeches
in advertisements, newscasts, articles, political speeches, and interviews
in literature, television shows, interviews, talk shows, and newscasts
in advertisements, literature, biographies, political speeches, and blog posts

Answers

Answer:

in advertisements, literature, biographies, political speeches, and blog posts

Explanation:

Please mark as brainliest

Answer:

In advertisements, newscasts, articles, political speeches, and interviews.

Explanation:

I did the test and got it right, you're welcome <3

what are the problems of teaching finance in schools​

Answers

There are not many cons, but often the most common argument against them is,

1) How "Unqualified teachers" are going to be teaching kids about financial literacy

2) How the school districts will fund these new courses

3) And how are they planning on adding these subjects to crowded curriculums

What does this characterization of Arnetta reveal?

her academic strengths
her loyalty to friends
her community involvement
her spiritual devotion

Answers

Answer:

her community involvement

Answer:

C. Her Community Involvement

Explanation: give brainliest please

using the information, how can on business increase its productivity?

Answers

Answer:

there's no information to use but.  Consider cultural fit when hiring. Your company's culture can include its values, ethics, expectations, and goals.  

Communicate clearly.  

Practice positive reinforcement.  

Empower your workforce.  

Develop your staff.  

Prioritize employee wellbeing.  

Be flexible.  

Set realistic goals.

Explanation:

hope this helps a little ig have a good rest of your day :)

Which statement best describes the Kid’s influence on Lizzie?

Answers

Answer:

what does the statement say?

The cat is sleeping.
The dog is sleeping.
Combine the sentences into one sentence.

Answers

Answer:

Both the cat and dog are sleeping.

How long yall think its gunna take fo, my teacher, to email me back I emailed him at 9:41

Answers

Answer:

Dang, that sucks. It depends on how his schedule is....

Explanation:

Last year, I did not ......... to Spain

Travel
Went

Answers

Answer: travel

Explanation: you can’t “went” somewhere if you didn’t go anywhere

Travel is the correct word. Went is the past tense form of go, but it would be the incorrect use of the word went in this example.

What does the word "incident" mean and why do you think Cullen uses thisword to describe the event in this poem?

Answers

Answer:

he is looking back from his childhood

Explanation:

Answer:

incident

1.

an event or occurrence.

2.

likely to happen because of; resulting from.

3.

falling on or striking something

Over the river and through the woods to grandfather's house we go.


What Is the Prepositional Phrase?

Answers

Answer: over the river, through the woods, to grandfather's house

Explaination: hope this helps

Answer:

over the river, through the woods, to grandfather's house

Explanation:

you can recognize a prepositional phrase by looking for a noun, pronoun, gerund, or clause. The object of the preposition will often have one or more modifiers to describe it.

here
ill give brainliest
ill report if u steeal

Answers

Answer:

the first one is d or steer and the second one is b

Explanation:

5.
Which sentence from the text helps develop the idea that rebellion can lead to serious kinds
of harm?
A. "They identify less with parents, do not want to be clones of the older child or
children who went before, and give themselves more latitude to grow in
nontraditional ways."
В.
"They must let the consequences of the young person's resistant choices play out
and not interfere."
"It can cause them to reject safe rules and restraints - letting impulse overrule
judgment to dangerous effect.
D. "So adolescent rebellion is not simply a matter of parental aggravation; it is also a
matter of concern."

Answers

Answer:

C

Explanation:

WILL AWARD BRAINLIEST

Describe how Romeo’s mood changes over the course of Act One. Use details from the text to justify how he was at the beginning of Act One, and how he feels at the end. What is the cause for this change?

Answers

whish I could help but if I can't read the text I can't help sorry

Read the directions. 9 points if you answer but 18 if you get brainleist

First, poke one-inch holes into the soil about 2 inches apart. Next, place one carrot seed in each hole. Third, cover the holes with soil. Finally, water the soil thoroughly.

What is the purpose of these directions?

A. to explain how to plant carrots
B. to tell about vegetable gardens
C. to give information about soil
D. to explain how carrots grow

Answers

Explanation:

A. to explain how to plant carrots

Other Questions
WILL AWARD BRAINLIESTDescribe how Romeos mood changes over the course of Act One. Use details from the text to justify how he was at the beginning of Act One, and how he feels at the end. What is the cause for this change? Is (1, -7) a solution of y=x-8?Yes Please help me with these questions FAST it's formal and I can't faillllllll!!!!!!, If you had to define ecological succession in your own words in a 140 character text, how would you define it? Dominique's age is 4 years less than twice brother's age b. Dominique is 12 years old. How old is her brother? Write an equation and solve using the replacement set of (6,7,8) pleaseeeeeee helpppppppppp Do a Hybrid CrossFill out the Punnett Square below for this story:Mary has blue eyes (bb) and David has brown eyes (Bb), if David and Mary have four children what will their eye color be? Will all their children have the same eye color? Why or why not.Child 1: Child 2:Child 3: Child 4: Thirteen more than three times a number is 25. What can you infer about the schools educational and social goals, based on Doves experiences? help would be appreciated ** if you could explain thatd be cool but if not thats ok Help me please Im begging u 3) What type of government did the Aztecs have? *A.One kingB. Prime MinisterC.PriestsD. Decentralized government made up of city states, each with their own kingsqueens what is 1256x - 14x + 16x simplified Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) list the difference between sdram and dram What is 2/5 divided 1/3 Kaden, Keith, and Kipp compete in a series of daily 3-way races. For each race, the probability that Kaden wins is 1/6, the probability that Keith wins is 1/2, and the probability that Kipp wins is 1/3. On a day that Kaden doesn't win, what is the probability that Keith beats Kipp? a file that serves as a starting point for a new document Solve for n.(33)^2 = n^6 A biologist is recording the loss of fish in a pond. He notes the number of fish, f, in the pond on June 1. On July 1 there were 63 fish in the pond, which is 52 fewer fish than were in the pond on June 1. What is the number of fish in the pond on June 1?Which equation can be used to find the number of fish in the pond on June 1?63f=52f52=63f52=63f63=52 i need help!!!!!!!!!