pleasee help meeeeeeeeee I’m stuckk!!!!

Pleasee Help Meeeeeeeeee Im Stuckk!!!!

Answers

Answer 1

Answer: Charles Babbage

Answer 2

Answer:

a

Explanation:

trust


Related Questions

KAPWING Video Editing Software allows you to use existing You Tube Videos in your design.

Answers

Answer:

Yea it should, it depends are you using a phone or a PC? because most of the time internally built in editing software on computers is better.

7.5 Code practice Plz answer ASAP

Answers

def calculate_GPA(grade, weight):

   grades = {"A": 4, "B": 3, "C": 2, "D": 1, "F": 0}

   if weight == 0:

       return grades[grade]

   else:

       return grades[grade] + 1

classes = int(input("How many Classes are you taking? "))

total = 0

for x in range(classes):

   letter = input("Enter your Letter Grade: ")

   user_weight = int(input("Is it weighted? (1 = yes) "))

   grade = calculate_GPA(letter, user_weight)

   total += grade

   print("Your GPA score is: ", grade)

print("Your weighted GPA is a",(total/classes))

I wrote my code in python 3.8. I was able to replicate the output in your picture exactly. If you need me to make any changes, I'll do my best.

The function is an illustration of for loops

For loops are used to perform repetitive operations; just like the while loop

The program in Python, where comments are used to explain each line is as follows:

#This defines the studentGPA function

def studentGPA(grade, weight):

   #This initializes a dictionary for all grades

   allGrade = {"A": 4, "B": 3, "C": 2, "D": 1, "F": 0}

   #This sets the return grade to 0

   retValue = 0

   #If the grade is valid

   if grade in allGrade:

       #If the weight is 0

       if weight == 0:

           #Then score is not graded

           retValue = allGrade[grade]

       #If otherwise

       else:

           #This adds 1 to the return grade

           retValue = allGrade[grade]+1

   #This returns the grade point

   return retValue

#The main begins here    

#This gets the number of classes

klass = int(input("How many Classes are you taking? "))

#This initializes the total grade to 0

total = 0

#This following is repeated for each class

for x in range(klass):

   #This gets input for the letter grade

   letterGrade = input("Enter your Letter Grade: ")

   #This gets input for the weight

   weight = int(input("Is it weighted? (1 = yes) "))

   #This gets the corresponding grade

   grade = studentGPA(letterGrade, weight)

   #This prints the grade point

   print("Your GPA score is: ", grade)

   #This calculates the total grade

   total += grade

#This calculates the GPA

GPA = total/klass

#This prints the GPA

print("Your weighted GPA is a",GPA)

Read more about for loop at:

https://brainly.com/question/12736327

Other Questions
What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.What is the best use of an atomic model to explain the charge of the particles in Thomsons beams?An atoms negative particles are surrounded by positive matter, so the positive particles are easier to remove.An atoms positive particles are surrounded by negative matter, so the negative particles are easier to remove.An atoms smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.An atoms larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove. PLS HURRY!!Can you tell how many different notes are played at a particular time (chords)? for manic by conan gray Tina Jones is a dancer specializing in Latin dance styles. She always wanted to have her own dance studio where she could teach dancing to young and old alike. In 2006, she opened her first dance studio, Electric Diva, in Madison Triangle. It was a great choice as a business location because its well-connected by highways to most places in the city. She leased the space for three years. Her initial investment included a good sound system, cheerful interior design, and strong flooring. To raise capital for the business, Tina turned to her brother-in-law, Philip. Philip made half the financial investment. He manages the accounts and social media needs of the business. He has a 30% share in Trishas business. Together, they expanded the business to three dance studios in the city and plan to open franchises in other cities. Which of the following is the BEST clue to the theme of astory?