Biology High School

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer 1

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

Related Questions

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

Explain the lifecycle of mosquito in short

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

dead cells are removed from the Dermis by phagocytosis. true or false?

Answers

The answer to your question is false I think.

PLEASE HELP I NEED HELP (Plant related / Project stuff)

Answers

Answer:

B, D, A, E, C

Explanation:

1. environmental factors

2. growth

3. adaptation

4. organism

5. genetic factors

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer:

The answer is the last one, skeletal remains

Answer: Skeletal remains

Thank you to anyone who answers .

Answers

Answer:

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.

Learn more about DNA here:

https://brainly.com/question/264225

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

In protein synthesis, how many nitrogenous bases code for a single amino acid?
one
two
three
four

Answers

3 nitrogenous bases code a single amino acid.

Answer:

Explanation:

EDGE 2022

4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks

Answers

Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 - Sensory neurons carry stimulus information to the brain or spinal cord.

3 - The brain processes the information through interneurons.

4 - Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO

Hope this helped!!!

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Other Questions

Given m||n, find the value of x. Which sentence is written correctly?A. If it is winter in the southern hemisphere, what is the season in the united states?B. If it is winter in the Southern hemisphere, what is the season in the United states?C. If it is winter in the Southern Hemisphere, what is the season in the united states?D. If it is winter in the Southern Hemisphere, what is the season in the United States?Please help, thanks giving brainliest!! *easy* Why wasn't the German army able to capture the capital city of Moscow There are 48 students in a class and 6 of them are girls. What percent are boys which set of ordered pairs is a function? Best answers will be marked Brainliest Give 2 advantages of the South. PLEASEEE HELP WORTH 30 AND WILL GIVE CROWN Which of the following light sources would a grower be likely to choose if the goals were to raise red spectrum light, maintain low temperatures, and keep costs low?LED grow lightshigh-pressure sodium lightsfluorescent grow lightsmetal halide lights Please help, test due in 2 hours! Will give good review and brainliest. Shelia's measured glucose level one hour after a sugary drink varies according to the normal distribution with = 132 mg/dL and = 11.3 mg/dL. what is the level L such that there is probability only 0.01 that the mean glucose level of 5 test results falls above L? Which type of niche applies to the clownfish?A. broad nicheB. medium nicheC. common nicheD. narrow niche The New World was an ideal place for the growth of representative government because-A. Political philosophers such as John Locke and Montesquieu were settlers in the New WorldB. Most settlers migrated to the New World to create a new form of governmentC. The rulers of the Old World were too far away to oversee the issues of settlers in the New WorldD. Settlers often had participated in representative governments in the countries they migrated from which of the following is not an example of temperature abuse If a basketball player makes 9 baskets in 12 tries, what is her ratio of baskets to tries, in lowest terms? Which best completes the analogy?:North Korea : Soviet Union :: South Korea : ____________________ aUnited Nations bGreat Britain cJapan dUnited States He is palying football into indiret speech REAL LIFE ISSUE!HELP PLEASE I NEED TO KNOW IF IM GOING TO BE HELD BACK!!!What grade point average would I have if I had 3 A's, 1 B, 1 D, and 1 F. la expecion del volumen