Answer:
What i can say is that WE ARE NOT.
Explanation:
Sexual selection is mostly our choices bc we have the uterus and body parts to produce babies. Some men take advantage of that hence rapxe. The evolution of males is sometimes in our control bc we are trying to teach them not to rapxe.
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
A planet has less mass than a galaxy and more mass than the star it orbits.
True
False
Answer:
False is your answer
A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?
Answer:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
Explanation:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.
During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.
The fathers gene may be dominant due to environmental circumstances or other factors.
Answer:
Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.
The climate influences ________
A. Plant growth
B. Biodiversity
C. Adaptions of land organisms
D. All of the above
Answer:
D
Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above
Answer:
The answer for this question is D
When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?
Answer:
Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.
Explanation:
Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.
Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.
What is antigen tests?An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.
Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.
To learn more about the Antigen click here
https://brainly.com/question/14453511
Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.
ITS C
What is meant by trophic levels?
Answer:
The position it holds in the food chain
Explanation:
A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.
Please help.................
Answer:
C i think.......................................
Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea
Answer:
Yes.
Explanation:
Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.
Thank you to anyone who answers .
Answer:
D
Explanation:
Answer:
i think its D but im so sorry if it wrong my second answer would probably be A
Explanation:
i really hope this helps sorry if it doesn't
The transfer of pollen from one flower to another flower on the same plant is known as
Answer:
Cross-pollination.............
The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?
Answer:
No organisms
Explanation:
This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
If a son has a sex-linked disorder, he received it from ______.
Answer:
tuff
Explanation:
i need help with #8, #10 please! whoever helps me, ill give brainliest <3
true or false
Photosynthesis is part of an oak tree's niche.
Answer:
True, veryyyyy true
:))
pollination of a flower or plant with pollen from a different flower or plant is known as
Answer:
Cross-pollination
Explanation:
cross-pollination is when pollen from one plant gets transported to another plant.
self-pollination is when pollen gets transported from the anther to the stigma of the same flower or a different flower on the same plant.
mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a mutation appear in the phenotype of an individual
The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.
What are mutations?Mutations refers to the changes that occur in the DNA of an individual organism. These chages may or may not change the appearance (phenotype) of the orgamsim.
The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.
Learn more about mutation:https://brainly.com/question/365923
What is another type of clean energy?
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
is planting trees in a forest In an investigation into the role of plants in the cycling of matter, a researcher is designing an experiment in which plants will be grown under conditions that will limit the rate of photosynthesis. Which design would match the goal of the researcher? M. Grow the plants in a low oxygen environment and measure the rate of carbon dioxide production. P. Grow the plants in a low carbon dioxide environment and measure the rate of oxygen production. R. Grow the plants in soil containing excess water and measure the rate of transpiration. S. Grow the plants in soil containing excess nitrogen and measure the rate of plant growth. Bi
Answer:
S
Explanation:
The growth of plant can be measured using the starch produced.
Deoxyribose (sugar). Total number in image?
Answer:
Formula: C5H10O4
Molar mass: 134.13 g/mol
Solubility in water: Very soluble
Melting point: 91 °C (196 °F; 364 K)
Appearance: White solid
Classification: Pentose, Deoxy sugar
_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron
Please can anyone help me in question 2&3
Answer:
2. Reflex action ( transmitting of nerve impulse)
3.Excitory
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
What are some ways you think scientists can affect or utilize the genes of organisms?
Answer:
I'm not quite sure what your looking for
Explanation: scientists can take the genes of one successful crop, animal, etc, and insert that gene into future things so all offspring will be successful. This is called genetically modifying. Another thing scientists can utilize genes for is cloning. There have been ideals of the perfect human for many years and now scientists are trying to alter these genes to have perfect offspring according to your standards.
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
