Physics High School

principle of quantization of charge​

Answers

Answer 1
Charge quantization is the principle that the charge of any object is an integer multiple of the elementary charge. Thus, an object's charge can be exactly 0 e, or exactly 1 e, −1 e, 2 e, etc., but not, say, 12 e, or −3.8 e, etc.
Answer 2

Answer:

Quantization is the process of replacing analog samples with approximate values taken from a finite set of allowed values.

Explanation:

Related Questions

A machine designed to stretch a stiff spring uses 1,550 J of energy to stretch the spring. If the work output is 1,200 J, what is the machine’s efficiency?

Answers

Answer:

77%

Explanation:

efficiency= work output/work input X 100%

e = 1,200j/ 1,550 j x100%

e = 1,200/1,550= 0.77

e = 0.77 x 100%

e = 77%

Which of the following is not true about a scientific name?

a. they should be typed in italics
b. they are derived from Greek and Latin words
c. they contain a genus and species name
d. they can vary from location to location

Answers

Then answer would be D

Ammonia is a common____?

Answers

Answer:

Base

Hope this helps! :)

Ammonia (NH3) is a common toxicant derived from wastes (see Figure 1), fertilizers and natural processes. Ammonia nitrogen includes both the ionized form (ammonium, NH4+) and the unionized form (ammonia, NH3). ... Temperature also affects the toxicity of ammonia to aquatic life.

Ayala is making salad dressing. She mixes oil and vinegar in a blender until a smooth consistency is formed. Explain whether this is a heterogeneous or a homogeneous mixture and why

Answers

Answer:Hetero

Explanation: Honestly, same as the last guy said

TEST INTRO 20

The fact that a pen drops when you let it go is an example that can help explain ...
A: the hypothesis of gravity.
B: the theory of gravity.
C: the gravity of the situation.
D: the law of gravity:

Answers

Answer:

D

Explanation:

What is one benefit of a cardio kickboxing workout?
A. It is a total body exercise.
B. It focuses specifically on aerobics.
C. It focuses specifically on anaerobics.
D. It focuses on the core muscles.

Answers

Answer:

D. It focuses on the core muscles

Answer:

A. It is a total body exercise

Explanation:

In cardio kickboxing as described by my school is "

a total body exercise that combines aerobic and anaerobic workoutsan improvement in body fat compositionan efficient use of workout timea boost in confidence and self-esteemrelief of stress and increased energy levelsvaluable self-defense skills

The first benefit is the one which we are focusing on because all the other answers are correct but A. Total body exercise is the best answer because it covers all of them as an compendious answer

Also I took the test and got this correct

Planetesmals are made from

Answers

A planetesimal is an object formed from dust, rock, and other materials. According to the planetesimal hypothesis, when a planetary system is forming, there is a protoplanetary disk with materials from the nebulae from which the system came. This material is gradually pulled together by gravity to form small chunks.

Brainliest or a thank you please :)) <3

Calculate the weight of a 2.3 kg squirrel

Answers

Answer:

Lemme think rq

*inserts writing noises*

*insert intese thinking*

*insert big brain moment*

Well the weight IS 2.3 kg so I think the weight of a squirrel is 2.3 kg

Name two things that Arjun and Diya did to get accurate measurements of the angles in their experiment

Answers

Answer:

i dont know them

Explanation:

What is the question. What angle?

According to ohms law, as the voltage increases across a 40 ohm resistor what happens to the current, resistors, and resistance

Answers

Answer:

As the voltage increases, the current flowing through the circuit increases while the resistance of the resistor remains constant.

Explanation:

Ohm's law states that the current flowing through a circuit is directly proportional to the applied voltage.

V = IR

where;

I is the current

R is the resistance

V is the applied voltage

Based on this law (Ohm's law), as the voltage increases, the current flowing through the circuit increases while the resistance of the resistor remains constant.

What could be the average human density? Justify?

Answers

Answer:

985 kg/m3

Explanation:

The average density of the human body is 985 kg/m3 k g / m 3 , and the typical density of seawater is about 1020 kg/m3 k g / m 3 .

Explanation:

the worldwide human population density is around 7,500,000,000 ÷ 510,000,000 = 14.7 per km2 (38 per sq. mi.). If only the Earth's land area of 150,000,000 km2 (58,000,000 sq. mi.) is taken into account, then human population density is 50 per km2 (129 per sq.

The tallest Ferris wheel in the world is located in Singapore. Standing 42 stories high and holding as many as 780 passengers, the Ferris wheel has a diameter of 150m and takes approximately 30 minutes to make a full circle. Determine the speed of the riders (in m/s) on the Singapore Flyer.

Answers

Answer:

The speed of the riders on the Singapore Flyer is approximately 0.262 m/s

Explanation:

The dimensions of the tallest Ferris wheel in the world are;

The diameter of the Ferris wheel, D = 150 m

The tine it takes the Ferris wheel to make a full circle, T = 30 minutes = 30 min × 60 s/min = 1,800 seconds

The angular velocity of the Ferris wheel, ω = 2·π/T

The linear velocity of the Ferris wheel, v = r·ω = The speed of the riders

Where;

r = The radius of the Ferris wheel = D/2

D = 150 m

∴ r = 150 m/2 = 75 m

∴ v = r·2·π/T

∴ v = 75 m × 2 × π/(1,800 s) ≈ 0.262 m/s

The speed of the riders on the Singapore Flyer, v ≈ 0.262 m/s

8. An electric force F exists between two objects, both having thecharge, q. If the charge on one object is doubled to 2q, the force
between the objects becomes
A. 1/4 F
B. 1/2 F
C. 2F
D. 4F

Answers

the answer is A 1/4f because it is doubled to 2q and you need to flip it

As distance ________________ between two objects, gravitational force will _________________. *
1 point
a. increases, increase
b. increases, decrease
c. decreases. increase

Answers

Answer:

b. increases, decrease

Explanation:

PLEASE HELP!!! *FOR TEST TMR*
What is the Scientific definition of Consumerism?

Answers

Explanation:

Consumerism is a social and economic order that encourages the purchase of goods and services in ever-greater amounts. ... In economics, consumerism refers to economic policies placing emphasis on consumption.

One of the most dangerous side effects of an erupting volcano is a

Answers

Answer:

One of the most deadly effects of a volcano is the ash coming from the eruption, which carries poisonous gases that are harmful to humans, plants, and animals alike.

Explanation:

:))))))))

Can some one please help me

Answers

Answer:

its "up, then down, then up"

Explanation:

A bird flies South for the winter at a constant force of 51 N. Suddenly a wind with a force of 35 N blows due South. What is the net force of the bird?

Answers

Answer:

86N

Explanation:

The bird is going south and the wind is also blowing south so all the force is acting in the same direction thus it all adds up.

What units are used to measure mass and weight?
O Mass and weight are measured in kilograms. O Mass and weight are measured in newtons. Mass is measured in kilograms, and weight is measured in newtons.
O Mass is measured in newtons, and weight is measured in kilograms. ​

Answers

Answer:

mass is measured in kilograms and weight is measured in newtons

Explanation:

Help it is timed help

Answers

Answer:

It is an object that remains a magnet forever.

Explanation:

pls help Which one of the following is NOT acceleration
A.
a change in mass
B.
a change in direction
C.
an increase in velocity
D.
a decrease in velocity

Answers

Answer:

C

Explanation:

Am increase in velocity?

Answer:

change in mass is not acceleration

If a fish is trying to capture insect hovering above the surface of water – how will it jump to catch it? Will it aim above or below what it sees? Explain.

Answers

Answer:

Above

Explanation:

yes

Electrical potential is measured in units called what

Answers

Answer:

Electrical potential is measured in units called volts.

What is sin(77°)? plz help​

Answers

Answer:

Value of Sin(77 degree) = 0.97437006

Degree / Radian Function

(angle in degree) (angle in radian) Sin Cos Tan Cot Sec Cosec SinH CosH TanH CosecH SecH CotH Arc Sin Arc Cos Arc Tan Arc Cosec Arc Sec Arc Cot

Can someone Please help me ?

Answers

up then down, think of it as like a rope

what forces are being used when walking a dog and how ?

Answers

There are tons of forces that balance out on your body while you walk. Subsequent physics classes will tell you about each and how they are represented. Here are a few in order of how people usually learn them.

Gravity: The earth exerts a gravitational force on each particle in your body that has mass. Overall, this can be represented as a single force that pulls directly toward the center of the earth from the point called your center of mass.

Normal Force: The contact between your feet/shoes and the ground exerts a force normal (straight out from) the ground. If you are on flat ground, this force is directly opposite the force of gravity, and in most cases will be equal to it such that you have no vertical net force.

Friction: Friction between your shoes/feet and the ground, pointing parallel to the ground and in the direction of your walking motion creates the force necessary for you to move. The microscopic peaks and valleys of the ground and your feet/shoes create small normal forces that can sum into a direction of motion.

Air Buoyancy: Since you are in a fluid, the mass of the fluid you displace creates an upward force away from the center of the earth. Since the density of air is miniscule, this force is generally neglected except in the most precise of circumstances.

Drag and Air resistance: While you walk, as you move through a fluid, that fluid exerts friction on your body in the form of drag. It is usually small unless you’re moving very fast relative to the fluid.

Air pressure, blood pressure, body tensions: Your body has a balance of blood pressure, muscle tensions, which oppose outside air pressures which equalize out to form the shape your body is in.

Internal forces: Many forces act within you such as air pressure, other muscle tensions, and internal stresses which balance out. Usually in physics these are lumped under internal forces.

Dos resistencias de 30 y 20 Ω se conectan en seria a un generador que tiene una diferencia de potencial de 20 V entre sus bornes. a. Determina la resistencia equivalente de la asociación b. Dibuja el circuito y coloca un amperímetro que indique el valor de la intensidad de la corriente y unos voltímetros que muestren la diferencia de potencial entre los extremos de las resistencias ¿Qué valores muestran estos aparatos?

Answers

Answer:

   V = 12V,  V = 8V

Explanation:

a) In this series circuit the equivalent resistance is

          Req - R1 + R2

          Req = 30 + 20

          Eeq = 50 Ω

b) see attached

c) the circuit current is

          i = V / Req

          i = 20/50

          i = 0.4 A

voltages are>

         V = 0.4 30

          V = 12V

           V = 0.4 20

            V = 8V

I need help plz!!! Please help...

Answers

Answer: 60

Explanation:

Eren Jagear supremacy? kind of.. rip? Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?​

Answers

sis i love the eren season 1-2-3-4 but the eren season 5?....... i just :')

Answer:

Explanation:

Aaron yogurt supremacy


Someone please help me

Answers

Answer:

A thesis should be a statement that can be argued.

Explanation:

Other Questions
2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond