Q1: what are the component of writing skill? Q2: list down and explain the five elements of effective writing?​

Answers

Answer 1

Q1:

domain knowledgeLanguage structuregrammatical accuracyProcessmodes/genrestraitsassessment(s)creativitytranscriptionReading comprehensionSymbolic understanding

Q2:

central ideaorganizationsupporting materialexpression, POV, word choicelanguage conventions
Answer 2

Q1: The components of writing skills are, grammatical skill, compositional skill, and domain knowledge.

Q2: Central idea, organization, supporting material, expression, word choice, and point of view. Spelling, Grammar, and Punctuation.


Related Questions

Determine which word or phrase, if any, is an interjection.

Hey! I see the parade coming

A.Hey

B.parade

C.neither​

Answers

Answer:

hey

Explanation:

exclamation mark behind it

What does the word alternate mean in this sentence?
A) taking turns
B) changing sides
C)hands on, active
D)other, substitute

Answers

Can you attach the sentence?

Explanation:

I need the sentence in order to answer

Your class is studying recycling. On the one hand recycling can help protect the environment. On the other hand recycling is inconvenient and places an added burden on citizens.
Do you feel recycling should be required of all citizens? Why?

Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.

Which of the following is the task for you?
a. Write an essay persuading your legislator to accept your recommendation on whether or not recycling should be mandatory.

b. Your class is studying recycling. On the one hand recycling can help protect the environment.

c. On the other hand recycling is inconvenient and places an added burden on citizens. Do you feel that recycling should be required of all citizens? Why?

Please select the best answer from the choices provided.

Answers

Answer:

A. Write an essay persuading your legislator accept your recommendation on whether or not recycling should be mandatory.

Explanation:

I calculated it logically

15 points
11. Choose one of the following prompts to discuss in a 1-paragraph
essay, using specific examples from the texts to support your reasoning,
Option A: Many of the characters or speakers in these selections are
struggling to find their way. Discuss at least one character from this unit
and explain their struggle. Use evidence to support your answer. Option
B: Some of the relatively recent stories and poems in this unit may be
ignored by future readers, and others may gain staying power and
appear over and over in anthologies like the one you are using. Select the
one that you think will last and that is still relevant to today and explain
your choice. Option C: Explain the impact of female writers during the
Post-modernist literary period. Using the story, "I Want to Be Miss
America," explain how stereotypes were discussed in literature during
this time period. Use two examples fro the story to support your
response. *
Your answer

Answers

Answer: C

Her pain seeps through her lettering slowly at first, then it rushes at the reader to make the strongest point of all; the standard of “American Beauty” is still haunting her to this day. One point I would like to bring up is that not all cultural standards are bad. There is some amount of stereotyping which we all must exist within the confines of if we are to live in this world.

I can feel her as an insecure teenager, and later as a wounded adult. She is strong, and I believe that she does not still exist within the confines of her standard of beauty that she had as a teenager, but she is very much aware of how this still affects her subconscious. I believe she would like to see the view of beauty (in today’s society) as allowing all people to be different, but all equally beautiful – without judgment. It is not impossible to change the very essence of who and what society is – after all, are we not the very people who create our own society on a daily basis? When one can realize this, one needn’t be stuck in this cultural muck (too terribly much). I have hope that things can change.

Explanation:

what should the punishment for cheating be 3 paragraphs

Answers

Answer:

rwq few ewf fds

Explanation:

wef wer  we

What do you infer could happen to Yanek if he is not quiet in the concentration camp?

a
He will be moved to another concentration camp
b
He will be seriously hurt or killed
c
The Nazis will not allow him to work anymore
d
He will be taken back to the Ghetto

Answers

I think the answer is B :)

Ryan learned that a summer job might not be that difficult TO GET
A It is an adverb modifying the
adjective difficult.
B It is a noun functioning as a
predicate nominative.
C It is an adjective modifying the noun job.
D It is a noun functioning as a
direct object.

Answers

ummmmmmmmmExplanation:

What is particularly odd about Mr. Collins' visit to Longbourn?
A) He proposes to two women in just a few days.
B) He is insistent on Elizabeth accepting his offer to marry, until she finally relents.
C) By the end of his visit he is engaged to two women.
D) He trades a his property for a wife.

Answers

The answer is C no problem ;)

What would you suggest that a reader do to better prepare himself for Shakespeare's writing to
make it more understandable, and therefore, more enjoyable?

Answers

Answer:

I would recommend SparkNotes, they have a No Fear Shakespeare, which is Shakespeare but written in normal English, super helpful.

Explanation:

Which one is it???????

Answers

Answer:

1

Explanation:

Is the word Pony long E or Short E?

Answers

Answer: short E

Explanation:

Answer:

I think it Long E but i could be wrong

Explanation:


What thoughts do you get when you see the picture. write a text on how to guide children and young people so that they can make independent and good choices when it comes to alcohol, drugs and tobacco.
heeeeelp me pleasssss just a few sentenses.​

Answers

Answer:

The first thing that comes to mind is of course dieases related to respiratory system. The most common and serious one being lung cancer. Children need to learn the consequences of taking drugs since their childhood in order to attain clear understanding. They need to improve self dependence and confidence from early age. The number of youngsters taking drugs is increasing day to day. In order to decrease this ratio not only parents are responsible but also the society.

Read the passage.

David’s car is broken. Until he gets a new car, he can either rent another vehicle, take the bus to work, or have his friend drive him to work.

Which organizational structure is used?

Answers

Answer:

he can rent another viechle because maybe he wont only go to work

Explanation:

knowing that others
are suffering, what are some ideas for
compassionately helping those around us?

Answers

Answer:

We must be aware of others suffering by always being open and empathetic towards those around us. By being empathetic, we can help others by listening to their problems and finding ways to aid them in solving them. We can talk to someone who might be lonely or do a job for our elderly neighbor. There are many ways to help others and we must always be looking for both big and small ways to make a difference.

Explanation:

Naomi is writing a memoir about an experience at her favorite music concert. She is writing using the first-person point of view. Choose the
correct way to complete the sentences in her memoir.
It is absolutely one of
enter the concert hall.
favorite memories. The day had been long awaited and
could hardly stop from jumping up and down with joy.
stood in line patiently waiting to
Reset
Next

Answers

Answer:

my, we, I

Explanation:

First person means from the perspective of the writer, so it is 'I' who is writing. This was correct on Edmentum.

What does “ablaze with admiration” means.

Answers

Answer:

Amazed and proud

----------------------

Hoped this helped

trike the iron while is hot​

Answers

Answer:

do you mean "strike while the iron is hot"?

Explanation:

It means that do it when the time is right.

example: if your parents went to best buy, and you wanted a game, thats is the perfect time to "show" them the game and they might want to buy it

Which detail best conveys the central idea of paragraph 4?
А Insects and seeds travel on birds that migrate or flee from storms.
B
The great frigate bird has an impressive, two-meter wingspan.
C
Berry seeds often drop into cracks and crevices and start to root.
D
Birds can loosen seeds and snails when they preen their feathers.

Answers

Answer:

А. Insects and seeds travel on birds that migrate or flee from storms.

Explanation:

The scientific article "Against All Odds: Earth's Fragile Pioneers" was written by Stephen James O'Meara for the Odyssey Magazine. In this article, O'Meara details the three specific ways life began on the island of Hawaii.

O'Meara reveals how birds, vegetation, insects, and all things now found in Hawaii have been. Though isolated and far from the other landmass, Hawaii began to have a life of its own, despite being "in the heart of the North Pacific." This can be attributed to birds, wind, and water. And in paragraph 4, he talks about how birds play a vital role in bringing about this life, either intentionally or not. According to O'Meara, insects, and seeds "hitch[ed] a ride on a migrating or storm-driven bird" and were dropped there on the island, which propagated and thus, helped in growing the life forms in the island.

Thus, the correct answer is option A.

Assignment
Write me a 100 word essay on how exercising and drinking water helps the body.

Please help

Answers

Answer:

Good hydration means getting the right amount of water before, during, and after exercise. Water regulates your body temperature and lubricates your joints. It helps transport nutrients to give you energy and keep you healthy. If you're not hydrated, your body can't perform at its highest level

Explanation:

A coworker did not clean his work area before going home. This could cause an accident, so you quickly clean up. The next day you see the coworker.
What would you be most and least likely to do?​

Answers

I would most likely ask him if it was on purpose or not and then suggest that it doesn’t happen again

I would least likely shout at him or report him to the superiors.that’s a bit harsh
I would address the situation and tell him that he needs to clean his work area the next time or I will report it instead of cleaning it for him.

she thought about the crowd, and it made things worse

Answers

this is poetic lolll

In fact, the differences between some of them (is/are) quite remarkable.
A. Is
B. Are

Answers

Answer:

B. Are

Explanation:

In fact, the differences between some of them are quite remarkable.

since the noun (them) is plural, use are instead of is

People are avoiding the woman on the bench because...

Answers

Hold on I will answer jhjjjjjjjjjj

Answer: Her appearance is peculiar

Which sentence uses a superlative adjective correctly?


Anthony is running more quickly than anyone else on the field.

Shalon is a very talented pianist.

That is the best chocolate cake I have ever tasted.

Ani is the better gymnast of the two.

Which statement best compares and contrasts the purpose of "PROSERPINE" to that of "How Old Man Winter Was Driven Back"?


The Greek myth explains the creation of the earth, while the Iroquois myth also explains why there is evil in the world.

The Greek myth explains the creation of the earth, while the Iroquois myth also explains the creation of the moon.

The Greek myth explains the changing of the seasons as well as the existence of the underworld, while the Iroquois myth also explains the changing of the seasons.

The Greek myth explains the creation of the moon, while the Iroquois myth explains the creation of the sun.


Read the passages:

from "How Old Man Winter Was Driven Back"

"I, too, am powerful, and I am young! I do not fear you. When I touch the earth, it grows soft and warm. Every living thing stirs in its sleep,—birds and bees, flowers and trees, animals and men. When I speak, the sleeping sun awakes. See! Already he begins to send down his arrows. Hasten! that they may not find you, on the trail to the North Sky."

from "How the World Was Made"

Even some of the trees went to sleep. Only the cedar, the pine, the spruce, the holly, and the laurel were awake all seven nights. Therefore they are always green. They are also sacred trees. But to the other trees it was said, “Because you did not stay awake, therefore you shall lose your hair every winter.”

Which best uses textual evidence to compare and contrast these two myths?


Both myths show the change in seasons as a violent battle.

In "How Old Man Winter Was Driven Back," the change in seasons is shown as an easy transfer of power. In "How the World Was Made," the change in seasons is shown as a natural, peaceful transition.

Both myths show the changes in seasons as a natural, peaceful transition.

In "How Old Man Winter Was Driven Back," the change in seasons is shown as a violent battle. In "How the World Was Made," the change in seasons is shown as a natural, peaceful transition.

Answers

Answer:

Which sentence uses a superlative adjective correctly?

Anthony is running more quickly than anyone else on the field.

Shalon is a very talented pianist.

That is the best chocolate cake I have ever tasted.

Ani is the better gymnast of the two.

Which statement best compares and contrasts the purpose of "PROSERPINE" to that of "How Old Man Winter Was Driven Back"?

The Greek myth explains the creation of the earth, while the Iroquois myth also explains why there is evil in the world.

The Greek myth explains the creation of the earth, while the Iroquois myth also explains the creation of the moon.

The Greek myth explains the changing of the seasons as well as the existence of the underworld, while the Iroquois myth also explains the changing of the seasons.

The Greek myth explains the creation of the moon, while the Iroquois myth explains the creation of the sun.

Read the passages:

from "How Old Man Winter Was Driven Back"

"I, too, am powerful, and I am young! I do not fear you. When I touch the earth, it grows soft and warm. Every living thing stirs in its sleep,—birds and bees, flowers and trees, animals and men. When I speak, the sleeping sun awakes. See! Already he begins to send down his arrows. Hasten! that they may not find you, on the trail to the North Sky."

from "How the World Was Made"

Even some of the trees went to sleep. Only the cedar, the pine, the spruce, the holly, and the laurel were awake all seven nights. Therefore they are always green. They are also sacred trees. But to the other trees it was said, “Because you did not stay awake, therefore you shall lose your hair every winter.”

Which best uses textual evidence to compare and contrast these two myths?

Both myths show the change in seasons as a violent battle.

In "How Old Man Winter Was Driven Back," the change in seasons is shown as an easy transfer of po

Explanation:

Determine how many formula units are in 2.35 moles of lithium phosphite?After reading the sources provided write a 250 word summary on the contributions of West Virginians to the war effort.1Describe the impact drought had on West Africa.

2Explain the positive and negative impacts of trade on the Kingdoms of Axum and Kush.

3Explain the impact of cultural diffusion on the spread of different religions across Africa.

4Choose two geographical features to visit in Africa. Tell me about the feature and why would you visit it?

5The Song dynasty impacted education through the invention of movable type. 6Choose and describe a modern-day invention that has a similar influence.

7How did the mining of gold and planting of cotton impact the economy and ecosystem in West Africa?

8Rank the Mongol leaders from least important to most important based upon what you learned in the lesson. Explain the rank of each person and the reason for their ranking.

, while the Iroquois myth also explains the changing of the seasons.

The Greek myth explains the creation of the moon, while the Iroquois myth explains the creation of the sun.

Read the passages:

from "How Old Man Winter Was Driven Back"

"I, too, am powerful, and I am young! I do not fear you. When I touch the earth, it grows soft and warm. Every living thing stirs in its sleep,—birds and bees, flowers and trees, animals and men. When I speak, the sleeping sun awakes. See! Already he begins to send down his arrows. Hasten! that they may not find you, on the trail to the North Sky."

from "How the World Was Made"

Ani is the better gymnast of the two.

Which statement best compares and contrasts the purpose of "PROSERPINE" to that of "How Old Man Winter Was Driven Back"?

The Greek myth explains the creation of the earth, while the Iroquois myth also explains why there is evil in the world.

The Greek myth explains the creation of the earth, while the Iroquois myth also explains the creation of the moon.

The Greek myth explains the changing of the seasons as well as the existence of the underworld, while the Iroquois myth also explains the changing of the seasons.

The Greek myth explains the creation of the moon, while the Iroquois myth explains the creation of the sun.

Read the passages:

from "How Old Man Winter Was Driven Back"

"I, too, am powerful, and I am young! I do not fear you. When I touch the earth, it grows soft and warm. Every living thing stirs in its sleep,—birds and bees, flowers and trees, animals and men. When I speak, the sleeping sun awakes. See! Already he begins to send down his arrows. Hasten! that they may not find you, on the trail to the North Sky."

Essay tests do not require students to present information in context.
Please select the best answer from the choices provided
T
ОО
F

Answers

Answer:

F

Explanation:

bc it is

Answer:  False!!!!

Explanation:  because I did the test and I got a 100

what is geothermal energy​

Answers

Answer:

Geothermal energy is heat within the earth

Explanation:

Answer:

Explanation:

Earth Heat Energy

write a short paragraph for this picture text features.​

Answers

Answer:

Following are the responses to the given question:

Explanation:

Friction ridges (raised) and undulations (recessed) mostly on pads of fingers and thumbs develop unique patterns. This unique design is used inside the absence of DNA, the criminal justice system depends on fingerprints to confirm a convicted perpetrator's identity or monitor its past arrests and convictions, violent tendencies, close criminals, as well as other relevant details.

What does Percy sense intuitively as he is about to confront Hades about the missing bolt? ​

Answers

Percy believes that confronting Hades is the wrong course of action and that he is missing something crucial. Percy is reassured by Annabeth that the solution is still in the Underworld because he saw ghosts of the dead.

Who stole the lightning bolt in Percy Jackson?

Once in Hollywood, Percy, Grover, and Annabeth use all three pearls to pass through the portal to the Underworld. Luke is exposed as the true thief when Hades discovers the lightning bolt in the Underworld that was concealed inside Luke's shield.

Zeus accuses Percy Jackson of stealing his Master Bolt for his father Poseidon, despite the fact that gods cannot steal each other's symbols of power and that Percy is the son of Poseidon and resides in New York City, the location of Mount Olympus.

Learn more about Percy Jackson here:

https://brainly.com/question/21755570

#SPJ1

What’s another way to say "an author’s perspective"?

A. the details an author uses
B. the author’s knowledge of a topic
C. how the author puts words together
D. the author’s point of view

Answers

Answer:

D. The author’s point of view.

Explanation:

The word "perspective" refers to the viewpoint, the standpoint of a person. In other words, a person's perspective is the opinion of that person.

An author's perspective is the viewpoint held by the author. This means the opinion or standpoint of the author. An author's perspective tells us what the author feels about something. It can shape the entire meaning of a text.

Thus, the correct answer is option D.

Answer:

D

Explanation:

I need help pls and thx :)

Answers

The first one, they all can help people stay healthy
Other Questions
Delta math question - Help me with number two please EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK What is the value of the residual for advertising dollars spent equal to $1,020 and Profit equal to $17,500? Round to the nearest integer. What is the Distance between (-5, -5) and (-9, -2) Help me pls!! (I will give brainliest) Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Graph f(x) = 6x^2-11+3 andfind the zeroes [tex]\sqrt[3]{11}[/tex] Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,,