Question 7
Gambling in the long run can never be an investment and is always about losing
money, not making money.
True.
False.

Answers

Answer 1
I believe it is false option 2

Related Questions

what does swagger mean​

Answers

Answer:

The description of the given topic is summarized throughout the explanation portion below.

Explanation:

Swagger enables you to create someone's API's configuration throughout order to facilitate machinery or computer to understand it.

The system can specify clients' API sequentially, or even have documentation or data throughout your programming language opportunities are being created.The power among APIs that could identify themselves would be at the core of Swagger's awareness.

Which of these is the Federal Trade Commission (FTC)?

A. cartel

B. consumer advocacy group

C. government contractor

D. competition regulator

Answers

Answer:

Explanation:

D: Competition regulator

The Federal Trade Commission is the Competition regulator. Thus, option D is correct.

What functions does the Federal Trade Commission have?

The Federal Trade Commission strives to stop unfair, dishonest, and fraudulent commercial activities. They also offer information to aid customers in recognizing, avoiding, and stopping fraud and scams.

Our goal is to defend consumers and the free market by eliminating unfair, dishonest, and anti-competitive corporate activities without unreasonably impeding legitimate commercial activity. We are the only federal organization that addresses concerns about financial regulation and competition in a variety of economic sectors.

The Federal Trade Commission is in charge of regulating the market. Option D is correct as a result.

Learn more about the Federal Trade Commission here:

https://brainly.com/question/891256

#SPJ3

3. According to Madison: (Select all that apply)
a) Ultimately, we must have faith that government will be run by enlightened statesmen who put themselves above politics and seek the public good.
b) Where there is no impartial judge to settle disputes the most powerful faction is likely to prevail
c) Settling disputes must be done by the people themselves, not by government authority
d) Many important acts of legislation, including taxation, require an impartial judge.

4. Why does Madison reject a pure democracy (a system where a small number of citizens assemble and administer the government in person)? (Select all that apply)
a) It can control factions if they are a minority but not if they form the majority
b) It doesn’t protect the weaker party in disputes
c) It cannot cure the mischiefs of faction
d) It is always incompatible with the rights of property and personal security

5. According to Madison, the true interests of the country are best determined by:
a) The election of a chosen body of citizens
b) The people themsleves
c) George Washington
d) By those committed to the protection of their property

Answers

Answer:

Read below

Explanation:

3: A ( Madison supported the good of the public )

4: C and maybe B (C because you can compare our world today that theres still some stuff needed to be fixed and maybe b because stuff like the Green's or whatever political parties that are small don't get there voice heard )

5: B ( since the country was meant to be decided by the people )

Until it was destroyed, the Library of Alexandria was important in Ancient Egypt because

A) Pharaoh Ramses II was buried there.
B) it taught most Egyptians how to read & write.
C) it served as center of learning and scholarship.
D) Caesar constructed it during his conquest there.

Answers

Answer:

The library of Alexandria was important in Ancient Egypt because C. it served as a center of learning and scholarship.

Hope this Helps!

Supporters of the view expressed in "An Awful Blot" would most likely call for
which of the following government actions?
O A. Expanded subsidies for industrial entrepreneurs
B. Increased regulation and oversight of industry
C. Reduced westward expansion into rural areas
D. Restrictions on strikes and labor stoppages
SUBMIT

Answers

Answer:

B increased regulation and oversight of industry

Explanation:

took the test

Answer:

Increased regulation and oversight of industry

Explanation:

Other Questions
Which limiting factor is this adaptation a response to 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet. What is one service the Freedmen's Bureau provided for African Americans?The agency provided funds to pay poll taxes.The agency set up courts to settle land disputes.The agency taught them how to cultivate crops.The agency found employment in Northern cities. Which of the following is a proportion?