Racing toward War
Place these events in the correct order
Archduke Ferdinand was
Austria declared war on
Russia mobilized its
Germany declared war on
Britain declared war on
assassinated
Serbia
forces
France and Russia.
Germany
Correct!

Racing Toward WarPlace These Events In The Correct OrderArchduke Ferdinand WasAustria Declared War OnRussia

Answers

Answer 1

The correct answer is Archduke Ferdinand was assassinated, Austria declared war on Serbia, Russia mobilized its forces, Germany declared war on France and Russia, and Britain declared war on Germany.

Explanation

The aforementioned events are part of the European warlike conflict known as World War I, which pitted the triple alliance against the triple entente. The first event that occurred during this war was the assassination of Archduke Francisco Fernando on June 28, 1914, at 11 a.m. in Sarajevo. After this, Austria-Hungary made a declaration of war against Serbia on July 23, 1914. This event caused Russia (allying with Serbia) to mobilize its troops towards the Baltic and Black Seas and the cities of Odesa, Kasan, Moscow, and Kyiv.

In response to Russia's military mobilization, Germany decided to declare war on August 1 and two days later on France (also allied with Serbia).

A day later, the United Kingdom entered the war by declaring war on Germany on August 4, since Germany had attacked Belgium even though it had remained neutral so far.

So the correct answer is Archduke Ferdinand was assassinated, Austria declared war on Serbia, Russia mobilized its forces, Germany declared war on France and Russia, and Britain declared war on Germany.

Answer 2

Answer:

1 Archduke

2 Austria

3 Russia

4 Germany

5 Britain

Explanation:


Related Questions

In what ways could the Black Death have led to improvements in health in surviving populations????????

Answers

Answer:

It could have lead to improvements like understanding how to quarantine properly, how to survive during it, staying home, etc.

I hope this helped!

Did the Olmecs settle near a river? What is the name of the area?

Answers

La Venta, ancient Olmec settlement, located near the border of modern Tabasco and Veracruz states, on the gulf coast of Mexico. La Venta was originally built on an island in the Tonalá River; now it is part of a large swamp.

What is the most important part of the United Nations?

Question 14 options:

The War Crimes Council


The Office of Finance


The General Assembly


The Security Council

Answers

Answer: What is the most important part of the United Nations? The answer is The General Assembly

Explanation: Hopefully this helps you with what ever u are doing for this question.

Question 7
Gambling in the long run can never be an investment and is always about losing
money, not making money.
True.
False.

Answers

I believe it is false option 2

What does the judicial branch do? Check all that apply.

It is B,C,E,F
Got it right

Answers

Answer:

ok..

Explanation:

Answer:

What does the judicial branch do? Check all that apply.

X creates new laws

O rules on legal cases

O explains the meanings of laws

X operates departments and agencies to carry out laws

O resolves disputes about laws

O decides whether a law is constitutional

Explanation:

edge 2021

Which of these is the Federal Trade Commission (FTC)?

A. cartel

B. consumer advocacy group

C. government contractor

D. competition regulator

Answers

Answer:

Explanation:

D: Competition regulator

The Federal Trade Commission is the Competition regulator. Thus, option D is correct.

What functions does the Federal Trade Commission have?

The Federal Trade Commission strives to stop unfair, dishonest, and fraudulent commercial activities. They also offer information to aid customers in recognizing, avoiding, and stopping fraud and scams.

Our goal is to defend consumers and the free market by eliminating unfair, dishonest, and anti-competitive corporate activities without unreasonably impeding legitimate commercial activity. We are the only federal organization that addresses concerns about financial regulation and competition in a variety of economic sectors.

The Federal Trade Commission is in charge of regulating the market. Option D is correct as a result.

Learn more about the Federal Trade Commission here:

https://brainly.com/question/891256

#SPJ3

What would you have done to survive in the Donner Party?Only answer if you're very good at History.Please don't put a link to a website.​

Answers

Answer:

Explanation:

I would have started by trying to bring a Native American guide along. It seems the Donner party wasn't very fluent in Native American customs, and before venturing into the west without an experienced guide. Sometimes having the right people on your team makes an effort easier.

Their fate was pretty much sealed by Jim Bridger, who hid letters from Edwin Bryant that advised against traveling on Hasting's Pass with wagons. At some point, before winter, I would have made a makeshift shelter for the women and children, and left a few men to guard them. I would have sent the rest of the men forward to explore the rest of the pass or find more help, fresh horses/oxen and more wagons to carry their belongings.

By stopping somewhere before winter, they could have taken advantage of any wild-grown food from the late summer and fall harvest seasons. When food got very scarce, I would have starved myself so my children would eat. I would like to say we would never have resorted to cannibalism. But desperation to keep children alive puts people's ethics at risk of being compromised. And for some, desperation to stay alive themselves makes them put their ethics aside.

I hope this gives you some ideas for your answer.

Which of the following explains the most likely purpose of Gonzalo’s answer to the second question in the interview?

Answers

Answer:

To justify the Shining Path’s use of violence to achieve its political objectives.

Explanation:

First, some context: the Shining Path was a revolutionary organization that endorsed employed guerrilla tactics and violent terrorism to overthrow the Peruvian government and establish a communist society.

In the interview, Gonzalo is asked about the people’s war. He discusses two of the aspects of this war. To state it simply, there needs to be change in a government.

This idea is used to promote the Shining Path and “demolish the outmoded Peruvian government.”

To justify the Shining Path’s use of violence to achieve its political objectives the most likely purpose of Gonzalo’s answer to the second question in the interview. Thus, option (c) is correct.

What is interview?

The term interview refers to a formal meeting with the involvement of two people as interviewer and interviewee. The interviewer is one who asks questions and the interviewee is one who answers questions. The conversion is related to the skills, knowledge, and experience related to the job.

Gonzalo’s answer to the second question in the interview was he discuss on the war. Gonzalo’s was they confidently answer the Shining Path’s use of aggression to accomplish its political aims. Shining Path was a revolutionary social group are the violent act of terrorism.

As a result, the significance of the Gonzalo’s answer to the second question in the interview are the aforementioned. Therefore, option (c) is correct.

Learn more about on interview, here:

https://brainly.com/question/13073622

#SPJ6

Your question is incomplete, but most probably the full question was.

Which of the following explains the most likely purpose of Gonzalo's answer to the second question in the interview?

A. To call for the prosecution of those responsible for mass violence in Peru

B. To challenge the continued political influence of Western states in Latin America

C. To justify the Shining Path's use of violence to achieve its political objectives

D. To appeal to politicians in Latin American states to adopt reforms to their respective political institutions

Until it was destroyed, the Library of Alexandria was important in Ancient Egypt because

A) Pharaoh Ramses II was buried there.
B) it taught most Egyptians how to read & write.
C) it served as center of learning and scholarship.
D) Caesar constructed it during his conquest there.

Answers

Answer:

The library of Alexandria was important in Ancient Egypt because C. it served as a center of learning and scholarship.

Hope this Helps!

Please!!!! Write a 500-word report describing some of the efforts of Americans as they supported World War II from the home front. This should include a paragraph about Rosie the Riveter and the government's efforts to encourage women and minorities into becoming part of the work force. Include in your essay specific examples of support for World War II from people who lived in your particular area at that time.

Answers

this was written by some other person named Mr. Donovan

America's home front changed dramatically during World War II. Due to the military draft, many men left their jobs in order to serve for the US. When these jobs opened up, women grabbed the opportunity to take a leadership role in America. Women had important jobs like building war materials like airplanes, guns, and ammunition. This increase in women in the workforce was inspired by the Rosie the Riveter campaign.

This campaign encouraged women with the famous phrase of "We Can Do It!" This was supposed to show women as courageous and strong individuals who could successfully complete the same work as men.

Along with this, African-Americans were also given more job opportunities in American society due to the increased demand for production of goods/materials for war. Besides domestic help, African-Americans were also recruited by the military to complete dangerous air missions. These elite men became known as the Tuskegee Airmen and completed thousands of missions during World War II.

I hope you pass your essay! good luck. Brainliest is appreciated

__

       M

            I

                N

                     S

P.S.

if u need help with anything, within the classes i'm good in [check pfp], u can contact me at

johnsonsummer{at}logoscharter.com

on Wed-Fri 8:45am--12:00pm and 1:30pm--3:00pm (During the western USA time, is appreciated)

What are common mistakes people make when investing

Answers

Answer:

Not Understanding the Investment.

Falling in Love With a Company.

Lack of Patience.

Too Much Investment Turnover.

Attempting to Time the Market.

Waiting to Get Even.

Failing to Diversify.

Letting Your Emotions Rule.

Explanation:

Economics is also weighing and choosing between two options before
your, by weighing what it will cost you to do or not to do that thing. You weigh the benefits and losses. True or false

Answers

Answer:

True.

Explanation:

Economics is also weighing and choosing between two options before you, by weighing what it will cost you to do or not to do that thing. You weigh the benefits and losses.

This cost benefit analysis is somewhat considered to be an opportunity cost.

Opportunity cost also known as the alternative forgone, can be defined as the value, profit or benefits given up by an individual or organization in order to choose or acquire something deemed significant at the time.

Simply stated, it is the cost of not enjoying the benefits, profits or value associated with the alternative forgone or best alternative choice available.

Other Questions
Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver I will mark Brainliest for frist answer This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Please real answers. Marking brainliest.How did Gerald Ford become president of the United States?A. He was elected president in a special election.B. He was vice president when the president resigned.C. He was elected president following an election campaign. D. He was appointed by Congress after the president was impeached. Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! "Hercules the Mighty." 7. In Scene 1, the line Its like tickling a butterfly contains *5 pointsA. a metaphor that tells you that butterflies are ticklish.B. a simile that tells you that the lyre must be played gently.C. symbolism that shows how lovely lyres sound.D. hyperbole that emphasizes how easy it is to play the lyre.