Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer 1

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51


Related Questions

AZT is a reverse transcriptase inhibitor. How does this drug prevent the replication of a retrovirus

Answers

Answer:

AZT is a thymidine analog

Explanation:

Azidothymidine (AZT) is an antiviral drug used for the treatment of the Human immunodeficiency virus infection (HIV/AIDS) by preventing the transmission of HIV from infected cells. AZT is capable of suppressing the activity of the enzyme reverse transcriptase of the retroviral HIV genome, which enables it to copy RNA into DNA. In infected cells, this double-stranded DNA is integrated into the host genome which is then instructed to produce identical HIV copies. AZT is a thymidine analog that is incorporated into DNA and thus interferes with DNA synthesis, thereby inhibiting cell proliferation.

fur color in mice is affected by a single gene the gene for fur color has two alleles: b that causes dark brown fur and b that causes light brown fur. What is or could be the genotyes of a mouse with dark brown fur

Answers

Answer:

(BB) or (Bb)

Explanation:

Given that (B) allele , is responsible for fur that is dark brown, and (b) allele is responsible for fur color that is light brown, the dominant allele is (B) allele for dark brown fur. Dark brown fur allele would always express itself over the recessive allele, (b).

For a mouse that has dark brown fur, the possible genotype it could have is either (BB) => 2 dominant allele, or (Bb) => 1 dominant allele and a recessive allele. The dominant allele would always express itself even in the presence of the recessive allele.

Properties of Water Lab Report

Instructions: Choose a property of water and design an experiment to test the property. Use the following lab template to ensure all lab report components are included.

Title:

Objective(s):
Identify the purpose of your investigation or the question you are attempting to answer. Be sure to tie in the property of water you are testing.

Safety Notes:
Always have parent(s) or guardian(s) permission and supervision when performing a lab activity at home.
Wear proper protective clothing and eyewear when needed.
Be sure to dispose of all materials properly.
Always wash your hands carefully after touching anything in a lab investigation.
Hypothesis:

Variables:
Independent Variable:
Dependent Variable:
Controlled Variable:

Materials:

Procedure:
The procedure should be clear and detailed so that others can repeat it. The details should be specific in how the procedure changes the independent variable, controls all variables that need to be controlled, and observes or measures the resulting changes to the dependent variable.

Data and Observations:
Present all data and observations in a neat and organized manner. Include tables and graphs where appropriate/possible.



Conclusion:
Be sure to answer the following reflection questions as a summary in the conclusion of your lab report:
Was your hypothesis correct? Why or why not?
What were the results of your experiment?
What changes would you make if you were to repeat the experiment?

Questions:
Using what you have learned in the lesson and the experiment, answer the following question in complete sentences.
Analyze the property of water you investigated and provide some real-world applications of the importance of this property of water.

Answers

Answer:

Hypothesis: I think the penny will hold more droplets plain water because adding soap to the water will disrupt surface tension

Independent variable: Penny and water dropper

Dependent variable: plain water

Independent variable:soapy water

Hope this helped

Design a controlled experiment to test the effect of water temperature on goldfish. be sure to include your hypothesis, independent variable, dependent variable as well as experimental group and control group.

Answers

Answer:

In this experiment, indepedent variable will be temperature and dependent variable will be the respiratory rate of goldfish. Temperature affects the respiratory rate of goldfish, as it's respiratory rate decreases with decrease in temperature of water, the experiment is as follows:

Take two glass containers filled with water A and B and put one goldfish in each container.Measure the temperature of the water using a thermometer.Count mouth movement of both the fishes in certain time.Now put some ice in container B that will decrease the temperature of water and measure the temperature again.Now count the mouth movement of both the fishes for the same time it was counted earlier.

The result will be that respiratory rate of goldfish decreases with the decrease in temperature in container B in comparison to container A goldfish.

An experiment meant to determine the cause of an effect, the effect is the independent variable, while the cause is the dependent variable

A controlled experiment to test the effect of water temperature on goldfish is designed as follows:

The experimental group are: The gold fish in a glass Jar X filled with fresh water and with the lid left open (the treatment of temperature reduction is applied to the experimental group)

The control group are: A second gold fish (selected at random) of the same size, in another glass jar Y filled to the same level with fresh water collected from the same source of the first gold fish

Independent variable: The independent variable is the temperature of the water which will be varied by placing ice cube gradually into the glass jar B

Dependent variable: The number times the gold fish gulp air by rising to the surface, and or the number of time goldfish opens its mouth, which indicates that the goldfish is breathing

The hypothesis: The breath rate of goldfish decreases with decrease in temperature because the goldfish metabolic rate decreases and the water holds more dissolved air and therefore oxygen at a reduced temperature

The Experiment Design:

The experiment is conducted by measuring the initial temperature and breathing rate of both fishes

The temperature of the fresh water in jar X is decreased gradually by adding ice cubes and recording the temperature and breathing rate of the goldfish

A similar experiment from an online source (Maryland School improvement website) the following results where obtained

[tex]\begin{array}{|c|cc|} \underline {Breathing \ rate}&&\underline {Water \ Temperature } \\&&\\ (Dependent \ Variable)&&(Independent \ Variable)\ \\&&\\103&&78.8 ^{\circ}F\\78&&68^{\circ}F\\55&&57.2^{\circ}F\\28&&46.4^{\circ}F\\4&&35.6^{\circ}F\end{array}\right][/tex]

From the experiment, it can be seen that the in the experimental group dependent variable, which is the breathing rate of the goldfish reduces as the temperature which is the dependent variable is reduced

Learn more about experimental variables here:

https://brainly.com/question/18177357

“Any process used to ask and answer testable questions about observations of the natural world” defines which term? scientific consensus scientific inquiry scientific conclusion scientific hypothesis

Answers

Answer:

The answer is B

Explanation:

I took the test

The way in which scientists observe, make a question or hypothesis and get the answers either by doing experiments or from available evidences is called as scientific inquiry. Thus, option B is correct.

What is scientific enquiry?

Scientific inquiry refers to a diverse way where scientists aim to get answers in the form of testable explanation either based on evidence from their previous work or from other observation. This can be used of their future experiments.

It has two important functions. Firstly, it provides a descriptive idea about the process of scientific inquiry conduction in practice.

Secondly, it gives an explanation of why scientific inquiry is successful in giving a genuine and reliable knowledge.

The order of scientific inquiry involves the steps such as observing, inferring, classifying, predicting, questioning, interpreting the results from experiments. Hence option B is correct.

Learn more about scientific inquiry, here:

https://brainly.com/question/16164242

#SPJ6

The process of ________ involves a carrier protein that can transport a molecule across the cell membrane down its concentration gradient.

Answers

Answer:

Answer is Facilitated diffusion.

The process of facilitated diffusion involves a carrier protein that can transport a molecule across the cell membrane down its concentration gradient.

What is facilitated diffusion?

The process of spontaneous passive movement of molecules or ions across a biological membrane by particular transmembrane integral proteins is known as facilitated diffusion.

To transfer molecules from one side of the membrane to the other without consuming energy, facilitated diffusion is required. Large and charged molecules require facilitated diffusion more than smaller molecules. These compounds are unable to readily diffuse through the plasma membrane.

It happens when chemicals like glucose or amino acids flow effortlessly from a high concentration to a low concentration.

Learn more about facilitated diffusion, here:

https://brainly.com/question/15162488

#SPJ6

Use the following scenario to answer the next following question(s):

You and your friends go to the beach for vacation. You all walk down to the beach to go swimming. When you get there, you see the water is murky and green, and there are algae blooms floating on top.

Reference: Ref 6-3

If it is excess nutrients which are feeding the algae blooms and lowering the oxygen content in the water, that process is called:
A. nutrient cycling.
B. nitrification.
C. eutrophication.
D. hypoxia.

Answers

Answer:

eutrophication

Explanation:

Eutrophication refers to a situation in which the aquatic environment becomes excessively enriched with nutrients. This leads to algal blooms in aquatic habitats such as lakes. These nutrients come from Fertilisers used in farming, which find their way into water bodies through run-off thereby increasing nutrient levels.

Excess nutrients causes phytoplankton to grow and reproduce at an alarming rate resulting in algal blooms. This bloom disrupts the balance in the ecosystem leading to many problems.

The algae may end up using all the oxygen in the water, causing oxygen shortage for aquatic life. Some of the algae may die, their decay may lead to further oxygen depletion. As oxygen is depleted, aquatic organisms may also begin to die.

If an experimenter wants to use the GFP method but needs to detect the presence or absence of several proteins at the same time, he can take advantage of mutational variants of GFP that emit what light?

Answers

Answer:

different colors

Explanation:

The green fluorescent protein (GFP) is a type of protein widely used in molecular biology laboratories because this protein can be used to detect the expression of proteins and to identify cellular structures. This protein displays green fluorescence when it is excited by blue light and, in the last years, many variants of the GFP protein have been developed. The altered GFP proteins react to distinct wavelengths of light, thereby emitting light to different colors. The mutants forms of the GFP protein are produced by genome engineering techniques that generate modifications capable of altering the folding of the normal GFP protein.

What are two major drivers of surface ocean current and deep ocean current? 1. Surface ocean current 2. Deep ocean current The choices are: A. Differences in water density, resulting from the variability of water temperature and salinity B. Global wind systems

Answers

Answer:

1-B 2-A

Explanation:

this is because the wind blowing over the water causes motion whereas deep water is effected by Differences in water density, resulting from the variability of water temperature and salinity


is the basic unit of structure and function of living things.

Answers

Answer:

cells

Explanation:

is the basic unit of life :)

The enzyme carbonic anhydrase catalyzes the formation of carbonic acid from carbon dioxide and water. Imagine that you have two sealed tubes with carbon dioxide gas above a buffer containing water and carbon dioxide. One tube has carbonic anhydrase and the other does not. After 24 hours, both tubes are at equilibrium. Which statement below accurately describes the conditions in the tubes?
A. The tubes will have equal concentrations of carbon dioxide and carbonic acid
B. The tube with carbonic anhydrase will have a lower concentration of carbon dioxide and a higher concentration of carbonic acid than the tube with any enzyme.
C. The tube with carbonic anhydrase will have a higher concentration of carbonic acid than the tube with any enzyme, but the concentration of carbon dioxide will be the same in both tubes.
D. The tube with carbonic anhydrase will have a higher concentration of carbon dioxide and a lower concentration of carbonic acid than the tube with any enzyme.
E. It is not possible to determine the relative concentrations of the products and reactants without more information about carbonic anhydrase, such as the Km.

Answers

Answer:

The correct option is B: "The tube with carbonic anhydrase will have a lower concentration of carbon dioxide and a higher concentration of carbonic acid than the tube with any enzyme."

Explanation:

Since there is an enzyme present that catalyzes (i.e., speeds up) the reaction, it will make the process more efficient and thus, the conversion of carbon dioxide to carbonic acid will occur quicker as compared to the tube that does not have the anhydrase enzyme included in it. More carbonic acid would mean lower concentration of carbon dioxide.

Old meristematic cells lose the capacity to divide and transform into ______ .

Answers

Answer:

Permanent Tissues

Explanation:

Permanent tissues: are derived from meristematic tissue once they lose the ability to divide. They are classified as simple and complex tissues.

What is the only source of energy production for RBCs?

Answers

Answer:

Anaerobic oxidation of glucose

Which is one of the bases found in DNA?
O A. Serine
O B. Leucine
O C. Lysine
O D. Cytosine

Answers

Answer:

D. Cytosine

Explanation:

The bases of the DNA(a material found in the Nucleus that contains genetic information) are four in number.

ACGT:

An acronym that stands for

A= Adenine

C= Cytosine

G= Guanine

T= Thymine

Hope this helps ;) ❤❤❤

Cytosine is the base which presents in the DNA. Therefore, option "D" is correct.

What is nucleotide base pairing?

There are five types of nucleotide bases adenine, cytosine, guanine, thymidine, and uracil. These divide into two classes of nucleotides pyrimidine and purine nucleotide bases. Pyrimidines are uracil, thymine, and cytosine whereas adenine and guanine are purines.

DNA consists of adenine, cytosine, guanine, and thymidine. In RNA, adenine, cytosine, and guanine are present but thymine is replaced by uracil.

Pyrimidine always binds with the purines through hydrogen bonding. Adenine binds with thymine. Cytosine binds with guanine. But when adenine pairs with uracil in RNA.

Therefore, these four bases are basic units of DNA.

Learn more nucleotide base pairing, here:

https://brainly.com/question/15900878

#SPJ7

y= -14x + 1.2 5 can be x or y

Answers

Answer:

Slope= 2.0002.400=1.200

x−intercept=−60​=−0.00000

y−intercept=50​=0.00000

Hoped I helped

When sweat cools on the skin, removing heat and cooling the body, what process is occurring? A. Parasympathetic nerve conduction B. Respiration C. Homeostasis D. Dehydration

Answers

Explanation: it has to be C because i got it right on my test

Gran Dolina adult hominids were similar to later Homo sapiens in their Group of answer choices None of these choices is correct. ability to produce art. wide nasal apertures. large cranial capacity.

Answers

Answer:

wide nasal aperatures

If a mother is affected by an X-linked dominant condition and the father is not, which children can inherit the condition?
only males
neither males nor females
both males and females
only females

Answers

Answer:

both males and females

Explanation:

The sex chromosomes in male and female humans are X and Y chromosomes. X-linked traits are those traits which are associated with the X- chromosome.

According to the question, the trait is passed on a X-linked dominant condition, which means that the possession or not of the condition is dependent on the presence of the dominant X-chromosome. The dominant X-chromosome will always express itself even when in an heterozygous state with a normal X-chromosome i.e Xx. Hence, only a individual recessive for the X-chromosome will be normal.

A mother that is affected by the X-dominant condition will either possess a; XX or Xx genotype while a father that is normal (not affected) will possess a (xY) genotype. Since the mother passes one of her X chromosomes to her sons and the other to her daughters, both male and female children will be affected by the condition.

N.B: If the mother is heterozygous for the affected X-chromosome (Xx), half of her sons and half of her daughters will inherit the condition but if the mother contains two dominant X-chromosomes (XX), all of her sons and daughters will inherit the condition.

One of the most common causes of acute tubular necrosis (ATN) is:________.
a. ischemic conditions.
b. cytotoxic agents.
c. immune reaction.
d. prolonged postrenal kidney injury.

Answers

Answer:

a. ischemic conditions.

Explanation:

Hello,

In this case, considering that acute tubular necrosis (ATN) has been widely acknowledged as a harmful medical condition showing off the death of tubular epithelial cells that give the form to the renal tubules of the kidneys; it presents with acute kidney injury. Thus, common causes of ATN include low blood pressure and use of nephrotoxic drugs which is more technically known as a. ischemic conditions in which the blood flow is very weak.

Regards.

What does ingestion and degradation of extracellular antigens and their subsequent presentation by MHC class II molecules lead to

Answers

Answer:

"Activation of CD4+ helper T cells" is the correct choice.

Explanation:

The major complicated of histocompatibility II seems to be the chemical compound for something like the T cells that presets antibodies. Antigens collected from those in the pathogens become transformed as well as inserted into a large histocompatibility system that's also distributed on either the cellular cell surface membrane representing antigen as well as the trigger is perceived by complicated systems of T cells as well as MHC II but rather contained throughout CD4 + support T cells.

Which of the following is the term for tightly packed sheets of cells that cover organs and outer surfaces?
a. Epithelial tissue
b. Connective tissue
c. Muscle tissue
d. Nervous tissue

Answers

Answer:

Epithelial tissue

Explanation:

The correct option would be the epithelial tissue.

Epithelial tissues are made up of tightly arranged cells and primarily functions as protective covers for organs and outer surfaces. Usually, a side of the component cells in epithelial tissue are in contact with organs which they are covering through a non-cellular basement membrane and the other side of the cells are free.

The non-cellular basement membrane that connects the cells in epithelial tissues to organs and surfaces is secreted jointly by the epithelial and connective tissues and usually made up of protein and carbohydrate.

Identfy the incorrect statement about active transport. a)It doesn't require the use of a cell's energy b)None of the choices. c)It moves substances across the cell membrane against their concentration gradients d)Sometimes active transport involves the use of carrier proteins to transport substances in much the same way as passive transport.

Answers

Answer:

can you please answer jahmarlon adu

Explanation:

please i will fail if you dont

The incorrect statement according to the question is “Active transport requires a cell's energy” option (a)  is correct.

Active transport is a cellular process that moves substances against their concentration gradients, from areas of lower to higher concentration. This movement of solutes against the concentration gradient necessitates energy expenditure by the cell. Active transport often involves the use of carrier proteins or pumps embedded in the cell membrane, which undergo conformational changes to transport substances across the membrane.

This energy is primarily provided by ATP hydrolysis, a process that releases energy from ATP molecules. In contrast, passive transport processes, like diffusion and facilitated diffusion, do not require energy expenditure and move substances along their concentration gradients. Thus, active transport distinctly relies on the cell's energy to function, option (a) is correct.

To learn more about transport follow the link:

https://brainly.com/question/29759743

#SPJ2

PLEASE ANSWER QUICK!Can the eukaryotic cells have a flagellum? Why or why not?

Answers

Answer: Yes.

Explanation: Both prokaryotic and eukaryotic flagella can be used for swimming but they differ greatly in protein composition, structure, and mechanism of propulsion. ... An example of a eukaryotic flagellate cell is the mammalian sperm cell, which uses its flagellum to propel itself through the female reproductive tract.

Is talc renewable???

Answers

Answer: Talc is a nonrenewable resource.

Explanation:

Talc is a mineral, which counts as a nonrenewable resource. Minerals, fossil fuels, and ores are nonrenewable resources because they do not regenerate or renew themselves at a quick enough rate and often take long periods of time to replenish.

who invented biology

Answers

Answer:

The term biology in its modern sense appears to have been introduced independently by Thomas Beddoes (in 1799), Karl Friedrich Burdach (in 1800), Gottfried Reinhold Treviranus (Biologie oder Philosophie der lebenden Natur, 1802) and Jean-Baptiste Lamarck (Hydrogéologie, 1802).

Explanation:

When was biology invented?

Antiquity

The science of biology was invented by Aristotle (384–322 BC). Before Aristotle, many Greek philosophers had speculated about the origins of the Earth and of Life, but their theorizing was unsupported by empirical investigation.

The gene encoding VEGFR2, the main receptor that binds and is activated by VEGF-A, is transcribed in almost every tissue type, but the VEGFR2 protein is rarely present. List and describe one mechanism that cells could use to reduce VEGFR2 protein levels despite high levels of transcription.

Answers

Answer:

The RNA interference (RNAi) mechanism

Explanation:

RNA interference (RNAi) is a biological process by which endogenous non-coding RNAs (ncRNAs) sequences target messenger RNAs in order to inhibit gene expression and translation. The regulatory ncRNAs bind by complementary base pairing to specific mRNAs and thus promote gene silencing by both posttranscriptional (mRNA degradation, block translation, etc) and by transcriptional (recruiting of histone/DNA modifying enzymes) pathways. The most common types of evolutionarily conserved ncRNAs found in plant and animal cells are 1-small interfering RNAs (siRNAs), 2-microRNAs (miRNAs), 3-piwi interacting RNAs (piRNAs, only present in animal cells) and 4-long noncoding RNAs (lncRNAs).

he most common source of osteomyelitis is an infection that migrates via the bloodstream. direct invasion from a fracture. surgical contamination. a joint prosthesis.

Answers

The correct answer is A. An infection that migrates via the bloodstream

Explanation:

Osteomyelitis is a serious condition, in which an infection develops in bones. This causes symptoms such as pain, inflammation, and can lead to the spread of the infection to other tissues or bone necrosis if it is not treated. In terms of causes, this condition develops when the bone is exposed to bacteria or similar that causes the infection, this can occur during surgeries or fractures. However, the most common source of infection is via bloodstream this means the bacteria or germ is in the blood and it enters the bone through the bloodstream. Also, once the bacteria or germ is in the bone it causes the infection.

which compound is produced during regeneration​

Answers

Answer:

RuBP

Explanation:

Ribulose 1,5-bisphosphate (RuBP) is an organic substance that is involved in photosynthesis. It is a colourless anion, a double phosphate ester of the ketopentose (ketone-containing sugar with five carbon atoms) called ribulose. Salts of RuBP can be isolated, but its crucial biological function happens in solution.

is the following nuclear equation balanced?

Answers

Please write the nuclear equation

which of Earth's systems was most affected by fossilized dinosaurs

Answers

Answer:

C. Lithosphere

Explanation:

Other Questions
The most widely used presentation software program is Microsoft PowerPoint. You can produce a professional and memorable presentation using this program if you plan ahead and follow important design guidelines.1. What text and background should you use in a darkened room? A. Dark text on a light background B. Dark text on a dark background C. Light text on a dark background 2. How can you customize existing templates?A. Eliminate boldface and italics B. Adjust the color scheme C. Add "visual cliches" D. Add a company logo E. Select different fonts The ramp in the railway station has rough surface .why? Consider the differential equation: 2y'' + ty' 2y = 14, y(0) = y'(0) = 0. In some instances, the Laplace transform can be used to solve linear differential equations with variable monomial coefficients. If F(s) = {f(t)} and n = 1, 2, 3, . . . ,then {tnf(t)} = (-1)^n d^n/ds^n F(s) to reduce the given differential equation to a linear first-order DE in the transformed function Y(s) = {y(t)}.Requried:a. Sovle the first order DE for Y(s).b. Find find y(t)= ^-1 {Y(s)} As part of the fastest growing type of tourism activity, more and more tourists attend the opera or ballet performances at their vacation destinations; visit museums, art galleries, folklore music performances; and go to Native American reservations, Hawaiian Luaus, or African native dance ceremonies. What type of tourism do these examples describe Quin es el presidente? Hace cuanto tiempo qu es presidente?ez ObradoEjemplo:Andrs Manuel Lpez Obrador es el presidente de Mxico desdediciembre 201851 Mxico-please see the example above.2 Colombia3 Espaa4 ArgentinaPer6 VenezuelaCHI7 Chile8 Ecuador9. GuatemalaSong10 Cuba11 Bolivia12. Repblica Dominicana13Honduras14Paraguay15. El Salvador16. Nicaragua17 Costa Rica18Panam19 Uruguay20 Puerto Rico21 Equatorial GuineaNeeds to be in Spanish 38. A pregnant client experiences persistent severe headaches and unexplained spells of dizziness during training, what should the trainer do? A complexometric titration can also be used to determine the amount of calcium in milk. The calcium concentration in milk is typically 1,200 mg/L. How would you alter the procedure used in this experiment to determine milk calcium content Read the passage and then answer the following question. You are a exchange student in Guatemala. You have arrived in Guatemala City and your host family is waiting for you in the airport. Abuelo: Hola, mi nombre es abuelo Carlos, bienvenido a nuestra familia. Mam: Hola, mi nombre es Olga. Estamos muy felices de tenerte con nosotros. Pap: Bienvenido, yo soy Jorge, el padre de esta familia. Sebastin: Hola, soy Sebastin, el ms guapo de esta casa y el hermano mayor. Cecilia: Y yo soy la mas pequea, bienvenido, hermano. What is Grandpa's name? Carlos Jos Sebastin Jorge A tank whose bottom is a mirror is filled with water to a depth of 19.6 cm. A small fish floats motionless a distance of 6.40 cm under the surface of the water.A) What is the apparent depth of the fish when viewed at normal incidence? B) What is the apparent depth of the image of the fish when viewed at normal incidence? What is the wavelength of an earthquake wave if it has a speed of 10 KM/S and a frequency of 5HZ? what are biogeochemical ? The numbers that Major Tallmadge assigned to members of the Culper Ring were from a secret writing system he invented. He substituted digits for words that would be used in messages. "Long Island," for example, was 728, "arms" was 7, and "city" was 88. There was a number for each month, such as 341 for "January." He made four copies of his codes. He kept one and gave the others to Woodhull, Townsend, and General Washington. For words that did not have a number code, Tallmadge gave his agents a cipher. In a cipher, each letter in a message is replaced by another letter or a number.Which statement is best supported by text evidence from the excerpt?A.All members of the Culper Ring received a copy of Tallmadges code.B.A cipher was a common instrument used during the American Revolution.C.Words that did not have a number code could not be used in secret messages.D.General Washington could read messages written in Tallmadges code. A mixture of gasoline and air explodes when it encounters a spark. This isknown asO A. a synthesis reactionO O OB. a precipitation reactionC. fuel efficiencyoD. a combustion reactionSUBMI 2(2x-5y)(3x+4y)-6(2x-5y)(x-y) factorise by taking out the common factors Select the correctly punctuated quotation. According to Dr. Brock at the Amazon Institute, "capybaras have webbed feet for swimming and can even sleep underwater by keeping their nose just above the surface for breathing." According to Dr. Brock at the Amazon Institute, "Capybaras have webbed feet for swimming and can even sleep underwater by keeping their nose just above the surface for breathing." "According to Dr. Brock at the Amazon Institute," capybaras have webbed feet for swimming and can even sleep underwater by keeping their nose just above the surface for breathing. "According to Dr. Brock at the Amazon Institute, capybaras have webbed feet for swimming and can even sleep underwater by keeping their nose just above the surface for breathing." Will a precipitate (ppt) form when 20.0 mL of 1.1 10 3 M Ba(NO 3) 2 are added to 80.0 mL of 8.4 10 4 M Na 2CO 3? The ____________ of a business firm is the system that details lines of authority, responsibility, and position, similar to the structure on organization charts. alculate the pH of the solution, upon addition of 0.035 mol of NaOH to the original buffer. Express your answer using two decimal places. when a watch is sold at ksh.126 a loss of x% is made if sold at ksh.154 aprofit of x%is realized .find the buying price When a deliverable arrived, Craig met with the team member responsiblefor ordering the deliverable to confirm it was the correct model and size.Which of the following project elements was Craig monitoring in this scenario?a. Budget b. Schedule c. Scope d. Risk