Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Which statement best describes the limits of science?
O A. Science can answer only mathematical questions.
B. Science cannot answer questions about the natural world.
C. Science can answer any question.
D. Science cannot answer questions about what people should do.
Answer:
A
Explanation:
science can answer only mathmatical questions
How is energy "lost" by organisms?
A.heat
B.cellular respiration
C. egested waste
D.biomass
Answer:
The think your answer is option B
Answer:
Heat energy lost by organism.
Explanation:
I think no A is the answer
Acid precipitation may change lakes by a. making phosphorus more available to plants, thereby increasing productivity. b. making nitrogen more available to plants, thereby increasing productivity. increasing populations of nitrogen-fixing microorganisms. . accelerating the carbon cycle within lakes. causing the local extinction of species that cannot tolerate
Answer:
causing the local extinction of species that cannot tolerate.
Explanation:
Acid precipitation may change lakes by causing the extinction of local species that cannot tolerate the acidity of the water. The acid precipitation damaged the skin of the aquatic organism as well as internal body structure of various organisms. Acidic nature of water is not good for all organisms except some resistance organisms due to their adaptability so we can conclude that extinction of species occur that has no resistance.
Woolly mammoths are an extinct species of elephant that lived in very cold climates.
They had very small ears.
Compared with the large ears of modern elephants, small ears would have assisted in
survival of the mammoths by
A. Decreasing the core body temperature
B. Increasing the effects of heat conduction
C. Increasing the radiation of heat from the body
D. Decreasing the surface area through which heat is lost
Answer:
The answer is B: Increasing the radiation of heat conduction
How did the mass extinction that killed the dinosaurs affect the evolution of mammals?
Answer:
With dinosaurs no longer eating them, mammals made quick evolutionary strides, assuming new forms and lifestyles and taking over ecological niches vacated by extinct competitors. ... Sixteen mammal species were discovered, with skulls and other bones fossilized after being buried in rivers and floodplains.
Explanation:
What impact did Jefferson’s Louisiana Purchase have on the nation?
Which of the following do animals gain from cellular respiration?
Carbon dioxide
O Sugar
O Energy
O Water
Answer:
carbon dioxide , Water
hope it help
I need help with this question
Answer:
Plz mark brainliest ;)
Explanation:
Lysosomes break down macromolecules into their constituent parts, which are then recycled. These membrane-bound organelles contain a variety of enzymes called hydrolases that can digest proteins, nucleic acids, lipids, and complex sugars.
Question 3 of 34
Which of the following explains how polar molecules form?
O A. The two atoms in a bond share electrons equally.
B. One atom transfers its electrons to another atom.
O C. Electrons are more attracted to one of the atoms involved in a
bond.
O D. Protons are more attracted to one of the atoms involved in a bond.
Is there difference between dorsal and posterior ?
Answer:
No not at all
Explanation
Answer:
No, they both mean the same thing.
Explanation:
Posterior (or dorsal ) Describes the back or direction toward the back of the body.
Sickle cell anaemia is an inherited autosomal recessive
condition caused by a mutation in the haemoglobin
subunit beta (HBB) gene. A male and female who are
phenotypically normal, discover through genetic testing
that they are both carriers of a HBB mutant allele. What is
the probability that their first child will be biologically
female and phenotypically normal?
Answer:
1/8 (12.5%)
Explanation:
An autosomal recessive disease is an inherited disease in which an individual need to receive both defective alleles at the same gene locus to be expressed in the phenotype. In this case, both parents are carriers of the recessive mutant allele associated with the sickle cell anaemia trait, thereby both parents are heterozygous, ie., each parent has one copy of the normal allele 'H' and one copy of the defective mutant allele 'h' associated with this condition. In consequence, their first child has a 1/4 (25%) chance of having sickle-cell anaemia. Moreover, the chance of having a girl is 1/2 and the chance of having a boy is 1/2, thereby the final chance of having a girl sickle cell anaemia individual is 1/4 x 1/2 = 1/8 (12.5%).
- Parental cross for sickle cell anaemia trait = Hh x Hh >>
- F1 = 1/4 HH (normal); 1/2 Hh (normal); 1/4 hh (sickle cell anaemia) >>
- Sex proportion of sickle cell anaemia individuals = 1/8 female sickle cell anaemia individuals + 1/8 male sickle cell anaemia individuals (1/8 + 1/8 = 1/4)
The cell membrane is described as being fluid because:
A. the phosphate groups move between fatty acids.
B. the membrane lets materials pass through it.
C. the fatty acid chains are inside it.
O D. the phospholipids move from side to side.
Answer:
D
Explanation:
The fluid mosaic model got its name because the plasma membrane resembles a mosaic formed by proteins embedded in a fluid of lipids. ... In the fluid mosaic model, the plasma membrane is basically composed of a lipid bilayer in which proteins are inserted.
Which is a reason why wetlands are important?
O They move water to higher ground during flooding.
O They filter pollutants out of water.
O They are estuaries.
O They provide minerals.
Answer:
They are estuaries
Explanation:
Groundwater _____. forms when precipitation seeps into the soil exists above the earth's surface is impossible to pollute is not a usable water source for humans
Answer:forms when precipitation seeps into the soil
Explanation:
Answer:
It's B
Explanation:
I got it correct when I did it on my quiz on oddseyware.
Which is not a component or stage of photosynthesis?
Which is not a component or stage of photosynthesis?
The light reactions
The Calvin cycle
An electron transport chain
The Krebs cycle
Answer:
I believe the answer is C, its been a while since I've learned this
1. Calculate the volume occupied by 0.845 mol of nitrogen gas at a pressure of 1.37 atm and a temperature of 315 K *
Answer:
[tex]PV=nRT \\ 1.37 \times V = 0.845 \times 0.083 \times 315 \\ V = 16.125 \: {cm}^{3} [/tex]
How do genes determine the traits of an organism?
Answer:
the Gene's make up every distinct feature about a creature like its hair color its ear size its tail size its teeth and especially its gender
Sita wants to grow sugarcane in the garden. She planted leaf ,stem and root of sugarcane,which of these will give rise to a new plant.
Answer:
The correct answer is - stem.
Explanation:
Sugarcane plants are grown from the cuttings of the sugarcane and planted in soil horizontally. There are rings present at each stem form by the falling of the old leaves. Roots come from the stems planted horizontally from small nodes present on stems.
Sit needs to cut the sugarcane stems and planted them in the soil horizontally to grow the sugarcane plant but it needs to be remembered that sugarcane plants required sunlight to grow.
what branch of biology deals with the study of herdity amd variation
Answer:
Genetics.
Explanation:
Genetics is a branch of biology concerned with the study of genes, genetic variation, and heredity in organisms.
An organism is born with a genetic variation not present in any of its ancestors. This variation is most likely the result of
A.circulation of blood
B.competition among individuals
C.respiration
D.a mutation in its DNA
Answer:
D
Explanation:
This is because circulation is blood,respiration and competition have no relation to changing the DNA of an organism
which player will generate the most FORCE??!!!
Answer:
Nick Boyle as 270 pounds is higher than others!
Explanation:
Answer:
Logan Thomas
Explanation:
The photos below show plant cells that are specialized for performing
photosynthesis.
Which part of these plant cells carries out this function?
A. Cell wall
B. Chloroplast
C. Cell membrane
D. Cytoplasm
The excretions of living organisms are best categorized as?
Answer:
The excretions of living organisms are best categorized as biotic factor in the environment.
Which of the following would be an accurate food chain that could be found in the
tropical community?
A) cougar --> turtle --> banana
B) insect --> frog --> ocelot --> parrot
C) fruit --> turtle --> cougar
D) vegetable --> insect --> mushroom
Answer: B
Explanation:
The animals that live in tropical areas are in option B. Cougars can not live in the tropics, they live in the cold biomes. In the tropics, there are many insects, and frogs eat them. Ocelots eat the frogs, and the ocelots are eaten by parrots. The rest of the options are valid food chains, but they would not function in the area of tropics. The answer to the question is option B.
which best explains a system
A structure that carries out a specific function
B group of organs that carry out different function
Croup of organs that work together to carry out a specific function
D way that organism operate
Answer:
C
Explanation:
Group of organs that work together to carry out a specific function - > Organ system
What things do plants use to get food matter?
HELP ASAP
Answer:
water and sunlight (for sure)
Answer:
Plants are called producers because they make their own food
Explanation:
Plants use minerals and water from the ground and their leaves absorb Carbon Dioxide (CO2) from the air.They convert these into food by using sunlight
Hope this Helped :)
Plants and animals are multicellular organisms made of organ systems that work together to maintain homeostasis. Body systems
are made of organs and organs are composed of tissue. Tissues are groups of cells that work together to perform functions.
Examine each of the examples below. Which of these are organs found in plants or animals? Select ALL that apply.
A
A
)
epithelial
B)
eye
leaf
D)
stem
vascular
The organs found in plants or animals is stem vascular. Therefore, option (D) is correct.
What are the features of the stem vascular?A stem is one of two main structural axes of a vascular plant, the other being the root. It supports leaves, flowers and fruits, transports water and dissolved substances between the roots and the shoots in the xylem and phloem, stores nutrients.
The vascular system of plants, complete with xylem and phloem, fills both purposes. Stems, along with roots, also store food for the plant. Pith, a tissue that lies in the center of the stem.
A vascular bundle is a part of the transport system in vascular plants. The transport itself happens in the stem, which exists in two forms: xylem and phloem.
Learn more about stem vascular:
https://brainly.com/question/12889528
#SPJ2
4. Many commercial grow lights deliver light mostly in the yellow/red part of the spectrum, along with smaller portions of all other visible light. Why would a grow light such as this promote plant growth and reproduction (flowering and fruiting) or is this a con job?
Answer and Explanation:
These lights can, in fact, promote the growth and reproduction of plants.
This is because growth, chlorophyll production, flowering and fruiting only occur if the plant is exposed to a band of light with 640-720 nm. Plants receive this band of light naturally through the sun, but when solar energy is not available it is possible to use cultivation lamps that emit this type of light band, which corresponds to the yellow/red spectra.
To obtain the atomic weight in an atom, add the:
To calculate the atomic mass of a single atom of an element, add up the mass of protons and neutrons. Example: Find the atomic mass of an isotope of carbon that has 7 neutrons
Is the chief justice of the supreme court the commander in chief of the military
No , The Chief Justice of the Supreme Court is not the Commander in Chief of the Military .
