Select the correct answer. What’s the significance to scientists of finding a new, unknown fossil?


A. It allows scientists to formulate new theories.
B. It enables scientists to better differentiate among the various species.
C. It proves that there’s an unlimited supply of fossils to be unearthed.
D. It provides evidence of links between evolutionary species.
E. It provides scientists with a reason to continue their research.

Answers

Answer 1

Answer: D. It provides evidence of links between evolutionary species.

Explanation: The significance to scientists of finding a new, unknown fossil is that it provides evidence of links between evolutionary species.

Answer 2

Organisms arose as a result of these changes, and some of their remains have been preserved as fossils. An organism's type, life history, and preservation method can all be ascertained by studying a fossil. Thus, option D is correct.

What are the features of finding a new, unknown fossil?

They can discover when and how various animals existed millions of years ago by studying fossils. Fossils can sometimes show scientists how the Earth has changed over time.

The discovery of a new, undiscovered fossil is significant to scientists because it shows connections between evolutionary species.

Fossils with remarkably similar geometries are thought to be from the same species. It is considered that fossils with somewhat differing geometries come from a separate species. Usually, the fossil species has been researched and given a name.

Therefore, It provides evidence of links between evolutionary species.

Learn more about fossil here:

https://brainly.com/question/24484886

#SPJ2


Related Questions

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Tara placed a grape in a solution, after sometime she noticed that the grape started to shrink.
a. Name the solution and explain.
b. Then Tara placed the raisin in a solution and noticed it started to swell up. Name the solution and explain

Answers

Answer:

a. Hypertonic solution

b. Hypotonic solution

Explanation:

There are basically 3 types of solutions in biology,

1) Isotonic-Same concentration of solute and solvent inside  the grape and in the solution.

2)Hypotonic solution-More concentration of solvent in the solution than in the grape.

3)Hypertonic solution-More concentration of solvent in the grape than in the solution.

Now,

a. Tara had kept the grape in a hypertonic solution. The solvent will start draining from the grape to equalize the concentrations of solvent inside and outside. So, the grape shrank due to loss of water.

b. Tara kept it in a hypotonic solution. The solvent will start entering the grape to equalize the concentrations of solvent. So, the grape started swelling.

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

A group of coordinately regulated structural genes with related metabolic functions, plus the promoter and operator sites that control their transcription, is called a/an ___________.

Answers

Answer:

They are called promoter and regulatory genes.

Explanation:

There are different genes responsible for regulating transcription:

These are the inhibitors, promoters and regulators.

Regulatory genes are in charge of regulating that promoter or inhibitor genes remain intact or do not present mutations.

Promoter genes promote cell replication, hence transcription.

In the case of malignant or benign neoplasms, there must be yes or if the affection of a regulatory gene plus the affection of an inhibitory or promoter gene.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Other Questions
Given that p=x^2-y^2/x^2+xy I. Express p in the simplest formii. Find the value of p, if x=-4 and y=-6 Northwest Fur Co. started 2021 with $105,000 of merchandise inventory on hand. During 2021, $510,000 in merchandise was purchased on account with credit terms of 3/15, n/45. All discounts were taken. Purchases were all made f.o.b. shipping point. Northwest paid freight charges of $8,900. Merchandise with an invoice amount of $3,700 was returned for credit. Cost of goods sold for the year was $362,000. Northwest uses a perpetual inventory system. What is ending inventory assuming Northwest uses the gross method to record purchases Tapestry Corporation will spend $1 million for special production equipment. Shipping and installation charges will amount to $175,000 and an initial increase in net working capital of $50,000 will be required. The equipment will replace an existing machine that has a salvage value of $85,000 and a book value of $100,000. Executives expect revenue to increase by $200,000 per year with no increase in operating expenses. If Tapestry has a corporate tax rate of 21%, what is the amount of the initial outlay for this project? Represents the solution to the inequality -9=2/3x-7 type in symbols to make 3,7,12,2 equal 45 i will mark brainalist! . You have two solutions, both with a concentration of 0.1M. Solution A contains a weak acid with a pKa of 5. ThepH of solution A is 3. Solution B contains a weak acid with a pKa of 9. The pH of solution B is: 20 points!Please help. the cube root of 2 to the seventh power 16.50 and pays 20.00 in cash the change due is MATHEMATICSAlgebraSimultaneous Equations1. 5u + 2v=7 2u - 2v=72. 3x - 4y=19 4x - 5y=23 Please help! Ive tried every site and nothing has helpedThe answer is 11.8 When two ionic compounds are dissolved in water, a double replacement reaction can... Group of answer choices occur if two of the ions form an insoluble ionic compound, which precipitates out of solution occur if the ions react to form a gas, which bubbles out of the solution never occur since all ions are in water occur if the ions react to form a gas, which bubbles out of the solution ionic compounds only react with nonmetals why is it important to take risks? Please answer this correctly without making mistakes How have Georgias rivers, such as the Savannah and the Chattahoochee, contributed to the states development? Check all that apply. They provide a source of hydroelectric power. They allow navigation from the coast up into the Blue Ridge and Appalachian Mountains. They provide water for agriculture. They were an important site for the development of trading cities, such as Augusta. They allowed settlers to travel from the coast inland more easily. They are rich in coal deposits, providing mining opportunities. Plzz help Ill mark brainliest Use the image to answer the question. What notes do you see? a. quarter and eighth notes b. whole and quarter notes c. eighth and sixteenth notes d. quarter and sixteenth notes help me please, ty Sally Eason put $4,000 in her deductible IRA this year. If Sally is in the 25 percent marginal tax bracket, the government actually contributed ____ of that amount for her. Group of answer choices A major traffic problem in the Greater Cincinnati area involves traffic attempting to cross the Ohio River from Cincinnati to Kentucky using Interstate 75. Let us assume that the probability of no traffic delay in one period, given no traffic delay in the preceding period, is 0.9 and that the probability of finding a traffic delay in one period, given a delay in the preceding period, is 0.6. Traffic is classified as having either a delay or a no-delay state, and the period considered is 30 minutes.Required:a. Assume that you are a motorist entering the traffic system and receive a radio report of a traffic delay. What is the probability that for the next 60 minutes (two time periods) the system will be in the delay state?b. What is the probability that in the long run the traffic will not be in the delay state?c. An important assumption of the Markov process model presented here has been the constant or stationary transition probabilities as the system operates in the future. Do you believe this assumption should be questioned for this traffic problem? Explain.