Some food material is given
below. What are the diffrent
possible ways of cooking them?
Find out and write them.
Meat - Groundnuts - Potatoes
Spinach​

Answers

Answer 1

Answer:

Meat-Boiling, Grilling, frying and roasting

Groundnuts-frying,boiling

Potatoes-Boiling frying and roasting


Related Questions

If you are preparing a report about the effect of climate change on sea level,
whose work would you be most likely to study?
A. Warren Washington
B. Edwin Hubble
O C. Christian Doppler
O D. Charles Kuen Kao

Answers

A. Warren Washington

Answer:

A. Warren Washington

I hope this helps you :)

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

how do each of the following factors affect the productivity in this process of photosynthesis ? 1)Temperature 2) Water 3) carbondioxide

Answers

Answer:

without the right amount of temperature and water photosynthesis won't take place and without the presence of carbon dioxide...there is nothing like photosynthesis

Explanation:

1) Temperature- Above 28°C of temperature photosynthesis will not take place faster as necessary. At this temperature, the enzymes responsible for photosynthesis will not work efficient as needed .  2)Water and 3)Carbon Dioxide-Water and carbon dioxide are the reactants in Photosynthesis which means they are taken in to produce energy. Six molecules of water and six molecules of carbon dioxide are needed to break apart glucose and produce energy.

Hope the answer helps! Don' forget to mark brainliest if the  answer is truly the  best. Thank you!

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Scientists are able to reproduce certain plants and animals by cloning them in laboratories. The diagram shows the steps of cloning using tissue cultures. Do you think cloning is a form of asexual reproduction? Explain your answer using evidence from the diagram

Answers

Answer:

Yes.

Explanation:

Yes, cloning is a form of asexual reproduction because there is no fusion of sperm and eggs takes place. the animal which is formed from this process is identical of that organism because it is produced from the tissue of that single animal. in 1996, first mammal is produced from cloning was sheep named dolly at the Roslin Institute in Scotland. In cloning, the egg is taken from female organism and remove the nucleus from the egg then the desired organism cell is taken and fuse with the nucleus with the help of electricity. Then implant this embryo in the body of first organism from where egg is taken and after that the embryo turns into a baby, this process is called cloning.

Answer:

Yes, cloning is a form of asexual reproduction. The diagram shows that new plants form from a single parent plant, which means that the offspring are genetically identical to the parent.

Explanation:

Edmentum

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

If a cell has 24 pairs of chromosomes in its diploid state, how many
chromosomes will it have after Meiosis 2?
A. 12
B. 24
C.48
D. 6

Answers

Answer:

option A is correct that is 12

Explanation:

meiosis occur in two phases in first phase DNA replication occur and amount of DNA become doubled without any change in the chromosome number and two daughter cell (each 2 n)are formed.

now in stage 2 each daughter cell undergoes mitosis with the formation of two cells with half chromosomes(n)

now 2n=24

n=24/2 =12

after meiosis stage 1...........two daughter cell each with  24 chromosomes

stage 2 .............each daughter cell form two grand daughter cell each with 12 chromosomes

net result.......4 daughter cell each with 12  chromosome(assuming cell as a diploid cell)

If a cell has 24 chromosomes before cell division then the daughter cell resulting from the mitotic division will have 24 chromosomes while the daughter cell resulting from the meiotic division will contain 12 chromosomes each.

The answer is option A.

What are meiotic and mitotic cell divisions?

There are sorts of cell departments: mitosis and meiosis. most of the time whilst humans discuss “cellular division,” they suggest mitosis, the procedure of making new frame cells. Meiosis is the sort of cell division that creates egg and sperm cells. Mitosis is an essential technique for lifestyles.

Learn more about mitosis and meiosis here: https://brainly.com/question/11842063

#SPJ2

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

what cell structure helps the cell stay flexible and maintain homeostasis?

Answers

Answer:

The cell membrane.

Explanation

I hope this helps you.

Based on fossilized evidence, there are scientific claims made about the evolution of certain species. If a scientist studying the fossils of a specific species had a hypothesis other than what was currently accepted, what steps should be taken to have the alternative hypothesis considered

Answers

Answer: For the scientist to have alternative hypothesis considered, it is imperative he takes certain steps, this steps will ascertain the scientific claims already made about the evolution of species.

Therefore,the scientist will simply test the alternative hypotheses inorder to know that they are incorrect.

This testing of hypotheses to ascertain their incorrectness is very useful in the study of fossils.

Can podocyte cells in the Bowmann capsule attach to any other basement membrane other than the glomerular basement membrane? That is, it can itself have a separate layer of base membrane?​

Answers

Answer:

"Podocytes are cells in the Bowman's capsule in the kidneys that wrap around capillaries of the glomerulus. Podocyte cells make up the epithelial lining of Bowman's capsule, the third layer through which filtration of blood takes place.[1] The Bowman's capsule filters the blood, retaining large molecules such as proteins while smaller molecules such as water, salts, and sugars are filtered as the first step in the formation of urine. Although various viscera have epithelial layers, the name visceral epithelial cells usually refers specifically to podocytes, which are specialized epithelial cells that reside in the visceral layer of the capsule. "

Explanation:

hope this helps

The scientist has chosen to study the motion of clouds in the atmosphere during a thunderstorm which type of model is most appropriate for her investigation

Answers

Answer: COMPUTER SIMULATION

Explanation: Computer simulation is a model that helps to scientists to have a clear and better understanding and be able to effectively predict the occurrence of future outcomes of real physical situations.

Computer simulation makes use of mathematical models to effectively analyse and predict future occurrences which helps the world to be better prepared and able to effectively manage physical and real world situations.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

18. Pepsin is an enzyme produced by stomach cells
to help digest protein. Stomach cells package
and secrete pepsin in which of the organelles

Answers

Answer:

Golgi bodies /apparatus

Explanation:

this organelles are responsible in for packaging and transportation of glyco proteins therefore are the organelles mainly involved in secretion of synthesised proteins

Pepsin is an enzyme produced by stomach cells to help digest protein. Stomach cells package and secrete pepsin Golgi bodies.

What are Golgi bodies?

The majority of eukaryotic cells contain the Golgi apparatus, sometimes referred to as the Golgi complex, Golgi body, or just the Golgi.

It packs proteins into membrane-bound vesicles inside the cell before the vesicles are delivered to their destination. It is a component of the endomembrane system in the cytoplasm.

It is situated close to the cell nucleus and the endoplasmic reticulum in the cytoplasm.

Pepsin is an enzyme that the stomach cells manufacture to aid in the breakdown of protein. Pepsin Golgi bodies are packaged and secreted by stomach cells.

Thus, the organelle is Golgi bodies.

For more details regarding Golgi bodies, visit:

https://brainly.com/question/13274076

#SPJ2

3. Which plants are usually the first to grow during secondary succession?
A ferns
Blichens
Cweeds
D trees

Answers

Answer:

ferns

Explanation:

these are alsi known as conifers which require a great amount if light

Im not a science student just trying beans I guess

Which organelle is the primary site of protein production? A) nucleus B) ribosomes C) cytoplasm C) cell membrane

Answers

Answer: b

Explanation:

Just trust

Answer:

B, ribosomes :)))))

Explanation:

Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom. Which group of organisms has the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom? sponges roundworms annelids chordates

Answers

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

Answer:

its b

Explanation:

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

2) Micah and Taylor investigate the effect of tap water and spring water on the growth of plants.

They grew two plants of the same type and size in separate containers. Every three days, they

added the same amount of tap water to one plant and the same amount of spring water to the

other. Describe an action that would best improve the reliability of their results?

Answers

Answer:

To improve the reliability of the results, the nutritional component of each category of water must be tested and recorded.

Second, the experiment should be carried out under greenhouse conditions.

The above actions will afford more control. When an experiment is controlled, it means that except for the dependent variable, all other variables are kept constant by the scientist.

By performing the experiment under greenhouse conditions, the kind of water the plants receive, temperature and other biotic actors are kept within measurable limits thus increasing the reliability of the results.

Cheers!

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

Match each hormone to its function
•luteinizing hormone
•testosterone
•oxytocin
•follicle-stimulating hormone
•estrogen
•gonadotropin-releasing hormone

Answers

Answer: Stimulates the contraction of the uterus during childbirth - OXYTOCIN

Stimulates sperm production and growth of ovarian follicles - FOLLICLE STIMULATING HORMONE

Initiates the Secretion of leutinizing hormone and follicle stimulating hormone - GONADOTROPIN RELEASING HORMONE

Initiates the development of secondary sex characteristics in females - ESTROGEN

Initiates the development of secondary sex characteristics in males - TESTOSTERONE

Initiates cell production of testosterone and estradiol by cells in the gonads - LUTEINIZING HORMONE.

The correct match for hormone and their functions are- 1- Oxytocin, 2- follicle-stimulating hormone, 3- a gonadotropin-releasing hormone, 4- estrogen, 5- testosterone, and 6- luteinizing hormone.

Oxytocin is a naturally occurring hormone that plays a vital role in the reproductive system of both men and women, including labor, delivery, and breastfeeding, as well as in human behavior.

FSH is produced by the pituitary, which is a small gland just below the brain. The pituitary plays a vital role in the development and regulation of sexual function.

Gonadotropin-releasing hormone stimulates the brain’s pituitary gland to produce and release the hormones LH and FSH.

Estrogen is a family of hormones that play a vital role in the reproductive and sexual development of women.

Testosterone is a male sex hormone. It is responsible for spermatogenesis and fertility in males.

Luteinizing hormones (LH) are hormones in the body that stimulate the reproductive system. Luteinizing hormone stimulates ovulation and stimulates the production of the hormones needed for pregnancy

To learn more about estrogen, refer to the link:

https://brainly.com/question/30246077

#SPJ6

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

Other Questions
Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? 10. Write a word problem for this equation:n ($25) = $125 To test the belief that sons are taller than their fathers, a student randomly selects 13 fathers who have adult male children. She records the height of both the father and son in inches and obtains the following data. Are sons taller than their fathers? Use the alphaequals0.10 level of significance. Note: A normal probability plot and boxplot of the data indicate that the differences are approximately normally distributed with no outliers.Height of Father Height of Son72.4 77.570.6 74.173.1 75.669.9 71.769.4 70.569.4 69.968.1 68.268.9 68.270.5 69.369.4 67.769.5 6767.2 63.770.4 65.5Which conditions must be met by the sample for this test? Select all that apply.A. The sample size is no more than 5% of the population size.B. The differences are normally distributed or the sample size is large.C. The sample size must be large.D. The sampling method results in a dependent sample.E. The sampling method results in an independent sample.Write the hypotheses for the test. UpperH 0 :H 1 :Calculate the test statistic. t 0=? (Round to two decimal places as needed.)Calculate the P-value. P-value=?(Round to three decimal places as needed.) Should the null hypothesis be rejected? Do not reject or Reject Upper H 0 because the P-value is less than or greater than the level of significance. There is or is not sufficient evidence to conclude that sons are the same height or are shorter than or are taller than or are not the same height as their fathers at the 0.10 level of significance. Click to select your answer(s). Often, myths are based on events that actually happened. How does a story become a myth rather than history? Historians decide that the event actually could have happened that way. As people retell the story, they add extra details to make the story more impressive. Once the story becomes part of history, people decide to add parts to it. A mythologist writes a book that includes a factual description of the event. Records indicate that x years after 2008, the average property tax on a three bedroom home in a certain community was T(x) =20x^2+40x+600dollars. Required:a. At what rate was the property tax increasing with respect to time in 2008? b. By how much did the tax change between the years 2008 and 2012? Sheridan Company, had 837000 shares of common stock issued and outstanding at December 31, 2017. On July 1, 2018, an additional 40600 shares of common stock were issued for cash. Sheridan also had unexercised stock options to purchase 31400 shares of common stock at $15 per share outstanding at the beginning and end of 2018. The average market price of Sheridan's common stock was $20 during 2018. What is the number of shares that should be used in computing diluted earnings per share for the year ended December 31, 2018 Identify the sentence that has the subordinating conjunction underlined and is punctuated correctly.A. Please take a few minutes to help me clean up, even if you feel you are too busy.B. We have to finish our work, before we can play a game.C. Although it is not fun to do chores everyone must do their share.D. You must finish your homework early because we have a busy night. What is the solution to this system of linear equations?y-x = 6y + x = -10(-2,-8)(-8.-2)(6.-10)(-10.6) Carlos is using the software development life cycle to create a new app. He has finished coding and is ready to see the output it produces. Which stage of the software development life cycle is Carlos ready for next? Coding Design Maintenance Testing Solve for x. 3x-91>-87 AND 17x-16>18 Water pressurized to 3.5 x 105 Pa is flowing at 5.0 m/s in a horizontal pipe which contracts to 1/2 its former radius. a. What are the pressure and velocity of the water after the contraction This lesson focuses on changes in African nations in the twentieth century. Think about the African countries youve heard of. List as many of these countries as you can. in a republic, sovereign power is held by those who are eligible to_____, while political is exercised by the representatives chosen by the citizens. the perimeter of square is 76 cm find are of square Try to get to every number from 1 to 10 using four 4's and any number of arithmetic operations (+, , , ). You may also you parentheses. Which of these conditions helped establish the foundation for a market revolution in the United States how many are 6 raised to 4 ??? who are the customers for textbooks? What do these customers want in terms of goods and services related to textbooks? From the publishers point of view, who are the key customer? How does efficiency lead to conformity? An annuity provides for 30 annual payments. The first payment of 100 is made immediately and the remaining payments increase by 8 percent per annum. Interest is calculated at 13.4 percent per annum. Calculate the present value of this annuity.