someone please find the area of this figure.

Someone Please Find The Area Of This Figure.

Answers

Answer 1

Answer:

to answer this question you have to first split up the diagrams,I'm to lazy to do that but I'll try

area of rectangle- 2mm×4mm=8mm²

area of rectangle 2-6mm×3mm=18mm²

area of rectangle 3- 4mm×2mm=8mm²

area of triangle =1/2 b×h

=1/2×6×18

=54mm²

total area = 8mm²+18mm²+8mm²+54mm²

=88mm²


Related Questions

what's the following rotational symmetries of oranges regular hexagon​

Answers

Answer:

rotational symmetry of 60 degrees around the origin - yes

rotational symmetry of 120 degrees around the origin - yes

Step-by-step explanation:

A regular hexagon has 6 congruent angles

the the angles created on the line of symmetry are equal to 60 so the angle of rotational symmetry is 60 degrees.

The regular hexagon, like stated before, has 6 congruent angles so the order of symmetry is 6

Here is a visual from basic-matematics

PLEASE HELP I WILL MARK BRAINLIST!!

Answers

Answer:

umm whats the question-

help you in what man?

there is no question

ANSWER FAST PLEASE!!

Answers

Answer:

D

Step-by-step explanation:

D is a function because it passes the vertical line test, meaning that you can draw a vertical line anywhere through the graph and it will only it the lines one time.

Answer:

D u welcome

Step-by-step explanation:

I'm cant say step by step

Write an expression that represents the area of only the red shaded region in terms of x

Answers

Answer:

1st find the area of bigger rectangle ie l×b

again find area of small rectangle ie l×b

now subtract area of small rectangle by bigger one you get the area of shaded part

“What is the gradient of the graph shown?”
someone please help I don’t understand how to do this.

Answers

Answer:

Step-by-step explanation:

It is easy to see that (-2, 0) and (0, -4) are points on the line.

gradient = (difference of y-coordinates)/(difference of x-coordinates) = (0-(-4))/(-2-0) = 4/(-2) =  -2

A brochure claims that the average maximum height a certain type of plant is 0.7 m. A gardener suspects that this estimate is not accurate locally due to soil conditions. A random sample of 43 plants is taken. The mean height of the plants in the sample is 0.65m. Using a 1% level of significance, perform a hypothesis test to determine whether the population mean is different from 0.7m. Assume that the population standard deviation is 0.2 m.

Answers

Answer:

We accept the null hypothesis, that is, that the population mean is not different from 0.7.

Step-by-step explanation:

A brochure claims that the average maximum height a certain type of plant is 0.7 m.

This means that the null hypothesis is:

[tex]H_{0}: \mu = 0.7[/tex]

A gardener suspects that this estimate is not accurate locally due to soil conditions.

Hypothesis test to determine whether the population mean is different from 0.7m, which means that the alternate hypothesis is:

[tex]H_{a}: \mu \neq 0.7[/tex]

The test statistic is:

[tex]z = \frac{X - \mu}{\frac{\sigma}{\sqrt{n}}}[/tex]

In which X is the sample mean, [tex]\mu[/tex] is the value tested at the null hypothesis, [tex]\sigma[/tex] is the standard deviation and n is the size of the sample.

0.7 is tested at the null hypothesis:

This means that [tex]\mu = 0.7[/tex]

A random sample of 43 plants is taken. The mean height of the plants in the sample is 0.65m.

This means, respectively, that [tex]n = 43, X = 0.65[/tex]

Assume that the population standard deviation is 0.2 m.

This means that [tex]\sigma = 0.2[/tex]

Value of the test statistic:

[tex]z = \frac{X - \mu}{\frac{\sigma}{\sqrt{n}}}[/tex]

[tex]z = \frac{0.65 - 0.7}{\frac{0.2}{\sqrt{43}}}[/tex]

[tex]z = -1.64[/tex]

Pvalue of the test:

Since we are testing that the mean is different of a value, and z is negative, the pvalue of the test is 2 multiplied by the pvalue of z = -1.64

z = -1.64 has a pvalue of 0.0505

2*0.0505 = 0.101

Using a 1% level of significance, perform a hypothesis test to determine whether the population mean is different from 0.7m.

0.101 > 0.01, which means that we accept the null hypothesis, that is, that the population mean is not different from 0.7.

Which equation can be used to find A, the area of the parallelogram shown? A = 5 × 9 A = 4 × 9 A = 12 × 5 × 9 A = 12 × 4 × 9

Answers

Answer:

I believe it's A=5 times 9 but since the triangle is special (3-4-5), it could be 12 times 5. Hope this kinda help :)

Let f be defined by the function f(x) = 1/(x^2+9)
(a) Evaluate the improper integral [tex]\int\limits^{∞}_3 {f(x)} \, dx[/tex] or show that the integral diverges
(b) Determine whether the series ∑n=3∞ f(n) converges or diverges State the conditions of the test used for determining convergence or divergence
(c) Determine whether the series ∑n=1∞(−1)n(en⋅f(n))=∑n=1∞(−1)n(n2+9)en converges absolutely, converges conditionally, or diverges (image put below)

Answers

(a)

[tex]\displaystyle\int_3^\infty \frac{\mathrm dx}{x^2+9}=\lim_{b\to\infty}\int_{x=3}^{x=b}\frac{\mathrm dx}{x^2+9}[/tex]

Substitute x = 3 tan(t ) and dx = 3 sec²(t ) dt :

[tex]\displaystyle\lim_{b\to\infty}\int_{t=\arctan(1)}^{t=\arctan\left(\frac b3\right)}\frac{3\sec^2(t)}{(3\tan(t))^2+9}\,\mathrm dt=\frac13\lim_{b\to\infty}\int_{t=\arctan(1)}^{t=\arctan\left(\frac b3\right)}\mathrm dt[/tex]

[tex]=\displaystyle \frac13 \lim_{b\to\infty}\left(\arctan\left(\frac b3\right)-\arctan(1)\right)=\boxed{\dfrac\pi{12}}[/tex]

(b) The series

[tex]\displaystyle \sum_{n=3}^\infty \frac1{n^2+9}[/tex]

converges by comparison to the convergent p-series,

[tex]\displaystyle\sum_{n=3}^\infty\frac1{n^2}[/tex]

(c) The series

[tex]\displaystyle \sum_{n=1}^\infty \frac{(-1)^n (n^2+9)}{e^n}[/tex]

converges absolutely, since

[tex]\displaystyle \sum_{n=1}^\infty \left|\frac{(-1)^n (n^2+9)}{e^n}\right|=\sum_{n=1}^\infty \frac{n^2+9}{e^n} < \sum_{n=1}^\infty \frac{n^2}{e^n} < \sum_{n=1}^\infty \frac1{e^n}=\frac1{e-1}[/tex]

That is, ∑ (-1)ⁿ (n ² + 9)/eⁿ converges absolutely because ∑ |(-1)ⁿ (n ² + 9)/eⁿ| = ∑ (n ² + 9)/eⁿ in turn converges by comparison to a geometric series.

&50+ E3 857=6180 150 #130 GELD Four girls have $5.00 to share equally. How much money will each girl get? Explain. What if four girls want to share $5.52 equally? Hov vill each

girl get? Explain.



answer is 5.00/4=1.25​

Answers

Answer:

Step-by-step explanation:

(5 dollars)/(4 girls) = (5/4 dollars)/girl = (1.25 dollars)/girl

:::::

(5.52 dollars)/(4 girls) = (5.52/4 dollars)/girl = (1.38 dollars)/girl

Suppose that you reach into a bag and randomly select one piece of candy from 4 chocolates, 8 caramels and 19
peppermints. Find the probability of selecting a chocolate.

Answers

Answer:

Step-by-step explanation:

4 : 31

4/31

or .129

or 12.9%

Answer:

4/31

Step-by-step explanation:

4 chocolates out of a total of 31 pieces of candy

Find the perimeter of a rectangle with a length of 9 yards and a width of 6 yards. Enter only the number of yards in the answer box. The perimeter is ____ yards.

Answers

Answer:

Step-by-step explanation:

30

In a local middle school, there are 20 Science teachers, 30 Social
Studies teachers and 600 students. What is the ratio between the number
of Science teachers and the number of students for this school? *
1:12.
1:30
1:35
1:40

Answers

Answer:

no of science teachers is 20

no of students is 600

ratio=20/600

=20:600

=1:30

pls give me brainliest

X/2-4=x/3
A 2
B 3
C 12
D6
Need it ASP

Answers

Multiply both sides of the equation by 6

x/2*6-4*6=x/3*6

3x-24=2x

This effectively got rid of all the fractions.

Now combine liked terms.

3x-2x-24+24=2x-2x+24     I subtracted 2x from both sides and added 24 on both sides.

x=24

We can check our answers

24/2-4=8

and 24/3=8 so my answer is correct

x=24

A line with a slope of 0 passes through the point (9,5). What is its equation in slope-intercept form?
Write your answer using integers, proper fractions, and improper fractions in simplest form.

Answers

Answer:y=x+5

Step-by-step explanation:

A χ2 goodness-of-fit test where all assumptions were met yielded the chi-square test statistic χ2=1.92 and a corresponding p-value of 0.75. The researcher interpreted the p-value as a 0.75 probability of observing a test statistic of χ2=1.92 or larger. What is wrong with the researcher’s interpretation?

Answers

Answer:

The researcher did not state that the p-value is conditional on the null hypothesis being true.

Step-by-step explanation:

The p-value or the assumed value represent the probability in which the test results that are received would be atleast extreme in that the null hypothesis would be correct

Here the wrong thing would be that researcher would not stated the p value is in conditional form based on the null hypothesis being true

Therefore the correct option is A.

Help shefeejhrhrhhtuy

Answers

Answer:

c. 80,360

Step-by-step explanation: multiply the number of cases they make each day by the amount of pastries each case contains

!!BRAINLIEST!! Is the opposite of I-5I 5?

Answers

Answer:

No. It is not. The opposite is -5

Step-by-step explanation:

I -5 I

The symbols; | | represents absolute value.

It gives the non negative value of that number irrespective of the sign of the number.

That is;

| -a | = a and | a | = a

So in this case;

| -5 | = 5

Opposite of 5 = -5

So the answer is FALSE!

What type of graph would the following data create? (0,2) (1,3) (2,4) is this a Positive slope linear graph

Answers

Answer:

Yes it's a positive linear graph

Step-by-step explanation:

Answer:

yes dear it's a positive linear graph.

Graph the inequality n > 1.8

Answers

Answer:

Open circle going right. <-- graphed

Step-by-step explanation:

1billion is the correct answerStep-by-step explanation:

If you can drive 340 miles in 5 hours, what is the unit rate? *
(2 Points)
Enter your answer

Answers

I believe it would be 68 miles per hour! To find the unit rate here you would divide miles by hours, or 340 by 5, which would give you 68.

factorise x^{2} +2x-24[/tex]

Answers

Answer:

(x + 6)(x - 4)

Step-by-step explanation:

x² + 2x - 24

(x + 6)(x - 4)

-4 and +6 multiply to 24 and add to +2.

Can someone help me please and show work thank you

Answers

Answer:

60% decrease

Step-by-step explanation:

To work out percentage change you takeaway the original number by the new number (New number-Original number) in this case 24-60=(-36), then divide the decreased amount by the original number and multiply the answer by 100 (Decrease amount ÷ Original number x 100) for this question you'd do (-36)÷60=(-0.6) then (-0.6)x100=(-60).

The minus shows its a decrease in percentage by 60%

(I hope this helps srry if it doesn't make sense)

My car magazine reports the numbers of miles driven for different amounts of fas for
Three car. Which car travels the fastest on 1 gallon of gas explain

Answers

Answer:

yes and no a.a

Step-by-step explanation:

Car A travels the fastest on 1 gallon of gas.

What is the unitary method?

The unitary method is a method for solving a problem by the first value of a single unit and then finding the value by multiplying the single value. The unitary method is a technique by which we find the value of a single unit from the value of multiple devices and the value of more than one unit from the value of a single unit. It is a method that we use for most of the calculations in math.

Given that car, the magazine reports the numbers of miles driven for different amounts of fas for Three car.

Consider us solving for the miles per gallon of individual cars

A. miles driven =140

A gallons= 5

x= 140/5

x= 28 miles per gallon

To learn more about the unitary method, please visit the link given below;

https://brainly.com/question/23423168

#SPJ5

Which inequality is represented by this graph? ​

Answers

Answer:

number 1

Step-by-step explanation:

need help answering this

Answers

Answer:

what ur yourgrade?

Step-by-step explanation:

Answer:

5) x=19 ft.

6) x=3 cm.

7) x=50 ft.

8) 56 mm.

Explanation:

All of these problems require proportions. For example, in #5, the smaller rectangle has a width of 8 ft. and a length of 24 in. and the larger rectangle has a length of 57 in. but the width is not given. Now, we know that [tex]\frac{8}{24}[/tex][tex]=\frac{x}{57}[/tex]. Cross-multiply to get 456=24x. Divide 24 on both sides to get x=19 ft.

Is it a right triangle please help!

Answers

Answer:

no

Step-by-step explanation:

Hello There!

We can figure out if the given side lengths form a right triangle using the Pythagorean Theorem

The Pythagorean Theorem states that the hypotenuse (longest side) squared equal to sum of the two legs squared

so if it is a right triangle then

[tex]74^2=71^+24^2[/tex]

[tex]74^2=5476\\71^2=5041\\24^2=576\\5041+576=5617\\5476\neq 5617[/tex]

5617 is not equal to 5476 therefore the given side lengths do not form a right triangle

~TheMathWIz

The Total cost to rent 5 chairs and 3 tables is $31 dollars. What is the cost to rent each chair and each table? No links please

Answers

Answer:

b

Step-by-step explanation:

Write the slope intercept form of the equation of the line. x + 8y = 24​

Answers

The answer is y= -1/8x+3

HELP I NEED HELPPP!!!!​

Answers

Answer:

<B=24

Step-by-step explanation:

<B=x

<A=5(x+7.2)

x+5(x+7.2)=180

x+5x+36=180

6x=180-36

6x=144

x=24

Answer and Step-by-step explanation:

When two angles are supplementary, the add up to 180 degrees.

Measure of angle A is 5 times the sum of the measure of angle B + 7.2.

So, we have b, and we have a.

a + b = 180

a = 5(b + 7.2)

b = ?

We input 5(b + 7.2) for a into the equation.

5(b + 7.2) + b = 180

Now we distribute the 5 and combine like terms.

5b + 36 + b = 180

6b + 36 = 180

Subtract 36 from both sides, then divide both sides by 6 to get b.

6b = 144

b = 24

The measure of angle B is 24 degrees.

#teamtrees #PAW (Plant And Water)

The large rectangle below represents one whole.

What percent is represented by the shaded area????

Answers

40% is shaded :))))))

Answer:

40%

Step-by-step explanation:

Because there are 5 rectangle total, we can dive 100% into 5 parts.

Each part is then 20%, there are 2 shaded rectangles thus the answer is 40%.

Other Questions
Please help with this. The coefficients of a quadratic equation are all integers.The discriminant is 0. Which statement best describes its roots?A) Two irrational rootsB) No real rootsC) One rational rootD) Two rational roots plz help im having a really tuff time right now Eloise spent $1.65 on potato salad that costs $0.25 per pound. How many pounds of potato salad did she buy? - Identify which 2 positions the Earth is in during an equinox. For what reason are the ideas of democracy and the practice of democracy in separately linked? Mr. Rogers wanted to study the affect of different types of music would have on students ability to complete the IA. What is his dependent variable? What Is his independent variable ?A. classroomsB. types of musicC. IA scoresD. students Monopolies are inefficient compared to perfectly competitive firms because monopolies produce output with average total cost exceeding average revenue produce output with average total cost exceeding average revenue A produce more output than is social desirable produce more output than is social desirable B charge a price less than marginal revenue charge a price less than marginal revenue C charge a price greater than marginal cost charge a price greater than marginal cost D charge a price less than average total cost A baseball is hit in the air. Its height above the ground is described by the function Ht=-16t^2+45t+5, where H(t) represents the height in feet of the ball t seconds after it is hit. To the nearest hundredth of a second, for how much time will the ball be in the air? Find algebraically. help guys plz i suck at math, also step by step is needed Branliest is the reward like always Help, please help!!!!!!!!!!!!!!!!! the difference of two numbers is 7. Three times the greater number is 72. find the numbers What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer??