Special care must be taken to store which of the following in a separate container of sanitizer?


cloths used for areas that been in contact with raw animal products such as beef, fish, or poultry

bamboo utensils

plastic utensils and containers

cast-iron vs. aluminum cookware

Answers

Answer 1

Answer:

cloths used for areas that been in contact with raw animal products such as beef, fish, or poultry

Explanation:

they could contaminate the clothes that have not been in contact with the raw poultry or fish


Related Questions

Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.

Answers

Answer:

Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

pushing a chair requires less energy than pushing than pushing a desk because

A. The surface area of the desk is larger.

B. The desk has less mass then then the chair

C. The chair has less mass then the desk

D. The chair is smaller

Answers

Answer:

c

the chair has less mass then the desk

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science

Answers

Answer:

Endoskeleton

Explanation:

Hope this helps!

Answer:

nerveos systum i think is tha anser

A single species can feed at only one tropic level

True

False

Answers

Answer: True sorry if I’m wrong.

Explanation:

Answer:

True

Explanation:

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

I’m confused help me pls

Answers

Claim: This process uses expensive fertilizers and pesticides to grow pest free crops which may be produced in excess. Explain the reasons why people would go against growing wheat this way.

Your answer: Here are 3 reasons that go against growing wheat this way.

1. The fertilizers and pesticides are expensive and cost farmers a lot which takes away from the revenue that farmers make from growing the crops in the first place.

2. Other then fertilizers and Pesticides its a lot of work as you can see on the chart throughout the year there are many things you must do too keep crops bug free and pest free this reason I'm explaining says that taking and doing all of this work for not pests/bugs is too much and not needed.

3. Fungicide Is needed a lot and incredibly expensive when you used/spray it on crops that much and point goes a lot more for large crops too.

If these reasons don't work, find factors that or counterclaims that go against this method of harvesting wheat. (This is what your supposed too do)

If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'

Answers

The answer to the question is

The number 20.

Hope this helps you. Sorry if i am wrong.

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

When and where would you expect to find the highest rate of primary productivity

Answers

Answer: Net primary productivity is the amount of gross primary productivity remaining after respiration, which is about 40 and 85 percent. Sloughs and marshes, as well as tropical rain forests, possess the highest rates of net primary productivity; deserts have the lowest.

Explanation:

I explained on the top-

The highest rate of primary productivity in terrestrial environments takes place in swamps and marshes and in tropical rainforests, and in aquatic environments it takes place in algal beds, estuaries, and reefs.  

• In ecology, primary productivity refers to the rate at which conversion of energy to organic substances takes place by the photosynthetic producers that attain energy and nutrients from the sunlight, and chemosynthetic producers that attain chemical energy via oxidation.  

• The majority of the energy assimilated by plants via the process of photosynthesis is not stored as organic substance, however, is utilized at the time of cellular respiration.  

• In the process, the organic components like proteins, carbs, and fats are dissociated to provide energy in the form of ATP for the metabolic needs of the cells.  

• The energy not utilized is stored in the tissues of the plants for future use and is known as the net primary productivity.  

• The highest net primary productivity in terrestrial environments takes place in marshes and swamps and in tropical rainforests, and in aquatic environments it takes place algal beds, estuaries, and reefs.  

These environments are mainly critical for the sustenance of global biological productivity.

To know more about:

https://brainly.com/question/14017102

99% of the GMOs on the planet are ____
or ____

Answers

Answer:

The answer would be pesticide producers and herbicide resisters.

Explanation:

Hope this helped!

Write mechanism of absorption​

Answers

Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)

Answer: I don't know

Explanation: i am brainless

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

Each Taxonomy (category) gets less and less specific as they go further down the list.

A. True

B. False

Answers

Answer:

B. False

Explanation:

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

Answer:

B. False

Explanation:

Taxonomy is the study of the general principles of scientific classification.

what are the effects of a change in protein? there is 3

Answers

Generally, mutations result in reduced protein function or no protein function. A mutation with reduced function is called a leaky mutation because some of the wild-type function “leaks” through into the phenotype. A mutation that results in no protein function is called a null mutation

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

Answers

Answer:

D) Factories and Photosynthesis

Identify what holds DNA, the hereditary information of a cell?

(Its not the nucleus)

PLEASE HELP!

Answers

Answer:

chromatin network or chromosomes

What does "synthesis" mean?
A. to read DNA

B. to tear apart

C. to make something

Answers

Answer:

I believe it is C to make something

C. To make something

what is a halflife in science?

Answers

One-half of the atomic nuclei of a radioactive sample to decay

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above

Answers

D is the answer you are looking for

Answer:

d

Explanation:

What was Darwins “
master work” titled

Answers

Answer:

Origin of Species by Means of Natural Selection

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

what are cells surrounded and protected by?

Answers

Answer:

cells are surrounded by a structure called the cell membrane — which, much like the walls of a house, serves as a clear boundary between the cell's internal and external environments. The cell membrane is sometimes also referred to as the plasma membrane.

Answer:

The plasma membrane, or cell membrane

Explanation:

What are the non-living components of an ecosystem?

Answers

Answer:

- Abiotic factors refer to non-living physical and chemical elements in the ecosystem.

- Abiotic resources are usually obtained from the lithosphere, atmosphere, and hydrosphere.

- Examples of abiotic factors are water, air, soil, sunlight, and minerals.

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen
Other Questions
Cameron is making trail mix. The ratio of peanuts to raisins to walnuts is 3:2:1. If there are 224 raisins, how many total peanuts and walnuts are there? Why would a manager begin the evaluation process by asking the individual to evaluate his or her contributions to the project? explain the contribution of nepal for maintaining international peace and security. The product of 4 and the depth of the pool Lifetime Health ch 19 review questions 1-20 its the version with 5 ppl on the cover Pliss you can help me Refer to the chart below.AmendmentEventA.First AmendmentA student applies for admission to a university and isprotected from racial discrimination.B.Fourth AmendmentThe FBI secures a warrant before entering a suspect's hometo search for evidence of a crime.C.Sixth AmendmentTo prevent self-incrimination, a defendant chooses not toanswer a prosecutor's questions.D.Ninth AmendmentA group of peaceful protesters assemble outside of a federalbuilding.Which of the following rows accurately matches the event with the amendment that addresses it? 00C Which of the following is the guiding economic philosophy of the free enterprisesystem?SocialismCommunisumMarxismCapitalism Identify the features of the Marshall Plan that helped to restore Europes economy. How do I do this ? no links please Suppose you receive the following ANOVA output in this study. What is the correct conclusion about this data (in correct APA format)? ANOVA Time Sum of df Mean Square F Sig. Squares Between Groups 91.467 2 45.733 4.467 021 Within 276.400 27 10.237 Groups Total 367.867 29 a. The effect of training on how long it takes to solve the problem was significant, F(2, 27)- 4.47, p> 05. b. The effect of training on how long it takes to solve the problem was significant, F(2, 27) -4,47, p .05. c. The effect of training on how long it takes to solve the problem was not significant, F(27, 2)-4.47, p >.05. d. The effect of training on how long it takes to solve the problem was significant, F(2, 29) - 4.47. p ,05. Duncan is putting icing on the top of a rectangular cake if the top of the cake is 6 inches wide by 10 inches long what is the area of the top of the cakeA. 80 square inches B.60 square inches C.30 square inches D. 120 square inches 2. W. Edwards Deming's chief contribution to industry after World War II wasA. to develop statistical methods and tools to monitor manufacturing operations,B. to organize business leaders to form quality assurance plans that could be used in manufacturing environments.C. to develop German industries to compete economically with U.S companies, thus improving the overall quality of products.D. to develop improved manufacturing operations with new technologies. What are the characteristic of a cell? help me :) which this question plzzzz !! Find k if (x+1) 2x^3+kx^2+1 h e l p pleaseeee is due in 30 min Consider the graph of the function f(x)=2x.Which statement describes a key feature offunction g if g(x) = 2f(x)? Answers:A. y-intercept at (0,2)B. y-intercept at (2,0)C. horizontal asymptote of y = -2D. horizontal asymptote of y = 2 Help meeeee SoS help me help me what is a kite? what are its properties? what is its use in our daily life?