Answer:
1.Embryo is an underveloped form of the bird at its early state of development usually few weeks old like a week.
2.Shell acts as it's outer covering.
3. Shell memberance acts as a semipermeable memberance for substances to leave or enter the Shell.
4. Air Sac contains a means of respiration for the Embryo.
5. Albumen is the part of the egg reach in protein or the white part you see after cooking.
6. Yolk contains the nutrient
7. Yolk Sac contains yolk
8. Amnion acts as shock observer, liquid suspension of the embryo and as a waste absorber.
9. Chorion is the outer embryonic memberance.
10. Alantios is a memberance that contains blood vessels that feeds the embryo,
Explanation:
Refer to the answers memberance is usually a surface that is permeable to certain substances.
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
The Seven Sisters are seven stars located more than 400 light-years away in the Taurus constellation and they can be seen here with Venus and another constellation, Orion. Why do these stars seem so small compared to our Sun, also a star?
A) Our Sun is much larger than any of the Seven Sisters.
B) Our Sun is much closer to Earth than the Seven Sisters.
C) The Seven Sisters are ancient stars; the Sun is a young star.
D) Stars found in constellations are much older and smaller than any other stars.
Answer:
The reason why these stars seem so small compared to our Sun is:
B) Our Sun is much closer to Earth than the Seven Sisters.
Explanation:
The reason behind this is that the sun is at a distance of the earth of 0.000016004 light-years. While the seven stars are at a distance of 400 light-years. Making them so far away that their size is reduced because in physics object size is altered by the perspective of the watcher or observer. Meaning that a ball the size of a car can be seen by our eyes as small as a bean if it is at the proper distance.
In a certain state, electricity is generated by using the earths heat. Wells drilled and natural steam is taken out through pipes. This natural steam powers the generator and the electricity generated. What type of energy is being used and what type of power plants are set up for harnessing this renewable energy?
Answer:
Geothermal
Explanation:
The geothermal energy is generated by the Earth's core that is a region with extremely high temperatures. The heat makes the geothermal power plants to work and thus generate energy from it.
The image shows groundwater zones.
Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.
Which is the saturated zone?
1
2
3
4
Answer:
The answer is 3
Explanation:
Hope this helps
Answer:3 or c
Explanation:
In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?
Answer:
immunosuppressant
Explanation:
After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.
All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
b. Why is it possible to move the object that way?
Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
Which is the best evidence that two species have a common ancestor?
A:The two species have the same diet.
B:The two species live in the same habitat.
C:The two species' skeletal structures are 90% identical.
D:The two species' DNA sequences are 90% identical.
Answer:
I'd go with D.
Explanation:
Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Describe natural selection
Answer:
Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.
Explanation:
El aparato respiratorio presenta unas células productoras de ... Que atrapan los gérmenes y el polvo. En su superficie tienen una gran cantidad de unas estructuras celulares llamadas ... Cuya función es extender el mucus y dirigirlo hacia el exterior. En el estómago, las glándulas digestivas producen el ... El cual, por su extremada ... Ataca y destruye a los ... Que se introducen con la comida y la bebida.
Answer:
The respiratory system has cells that produce MOCO OR MUCUS, which trap germs and dust. On their surface they have a large number of cellular structures called CILIAS, whose function is to spread mucus and direct it outwards. In the stomach, the digestive glands produce the STOMACH ACID, which, due to its extreme ACIDITY, attacks and destroys the PATHOGEN MICROORGANISMS that are introduced with food and drink.
Explanation:
In the respiratory and digestive apparatus there are two types of super specialized mucous upholstery, where the cellular world is challenged.
In the respiratory mucosa the production of mucus and the mobilization of the cilia are part of the innate response of the organism as well as the acidity that is generated in the upholstery and in the gastric tract.
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
Please help me, thank you!
Gene: is a unit of heredity which is transferred from a parent to offspring and is held to determine some characteristic of the offspring. An example is hair or eye color
Allele: is different forms of a gene. An example would be how tall or short.
Homozygous: is two alleles that are the same trait. An example would be two alleles for straight hair.
Heterozygous: is two different traits like one for staright and one for curly hair.
Dominant: is the stronger form of an allele. Like the grey fur is the stronger one
Recessive: is the weaker form of an allele. Like white hair is the least likely.
Pheneotype: is the physical apperance.
Genotype is the genetic makeup of an organism.
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
Drag each description to the correct type of succession.
vacant parking lot for many years
Primary succession
Secondary succession
abandoned baseball field
recently cooled lava field
rocky hill under a melted glacier
clear-cut forest
1) Intro
Done
ivity
Answer:
1) vacant parking lot for many years (secondary succession)
2) abandoned baseball field (secondary succession)
3) recently cooled lava field (primary succession)
4) rocky hill under a melted glacier (primary succession)
5) clear-cut forest (secondary succession)
Explanation:
Succession in ecology is the gradual encroachment of life on a given ecosystem.
Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.
Answer:
PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.
Explanation:
it's correct
Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ
Answer:
A
Explanation:
Egg cell
The level of structural organization which best describes an egg is: A. a cell.
A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.
The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.
An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.
In conclusion, the level of structural organization in animals cells can best be describe by using an egg.
Read more: https://brainly.com/question/19559847
PLS HELP ME!!!!!!!!!!!
Answer:
From the mouse
Explanation:
It is directly gaining energy from the mous because the mouse is what gives the snake energy and if the snake directly consume it, it will get energy from it.
Birds can regulate their body temperature, they are
(A) ectothermic
(B) endothermic
(C) mesleothermic
(D) hydroponic
Answer:
b
Explanation:
Birds are Endotherms since they generate more heat to control their body temperature and so unlike ectotherms, bird's regulating of body temperature is based on internal rather than external(environmental) factors.
Biogeochemical cycles _______.
Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.
Explanation:
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
how did darwin’s theory of evolution change the way biologists thought about classification categories
Answer:
hhh3h3h3hgegegegegeggegsgsggs
y
Explanation:
hhhhhhshshshshhdhdhdhghdhgd
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
What percentage of Japan’s population is between the ages of 0–4 years?
Answer:
looks like about 8% to me
40 to 44 percent of people are in the range of 0 to 4 years.
What is the population?A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.
In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.
In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.
Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.
To learn more about the population, refer to the link:
https://brainly.com/question/27991860
#SPJ2
Glaciers pushing rocks against rocks is an example of
Answer:
Erosion??
Explanation:
Answer:
Glacial Erosion
Explanation:
In ancient times, why would a cloudy day make it so hard to tell what time it is?
Answer:
Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time
