The best way to characterize public relations at Under Armour is to use the label Multiple Choice fund raising. political public relations. marketing public relations. relationship management. publicity

Answers

Answer 1

Answer:

The correct answer is the option: Marketing Public Relations.

Explanation:

To begin with, the concept known as "Public Relations" in the marketing field refers to the instrument that the managers have and they can use with the purpose to establish better relationships with the public and with the target audience that the company has. The major goal of the public relations strategy is to know how to engage the company in relationships with outside agents that can benefit the company in its image to the customers. Therefore that this type of strategy focuses on the actions that the company can take in order to increase its public image to the society.


Related Questions

The net income reported on the income statement for the current year was $121,900. Depreciation recorded on store equipment for the year amounted to $20,100. Balances of the current asset and current liability accounts at the beginning and end of the year are as follows: End of Year Beginning of Year Cash $48,030 $44,190 Accounts receivable (net) 34,440 32,660 Merchandise inventory 47,020 49,710 Prepaid expenses 5,280 4,200 Accounts payable (merchandise creditors) 45,000 41,800 Wages payable 24,590 27,310 a. Prepare the Cash Flows from Operating Activities section of the statement of cash flows, using the indirect method. Use the minus sign to indicate cash outflows, cash payments, decreases in cash, or any negative adjustments. Statement of Cash Flows (partial) Cash flows from operating activities: $ Adjustments to reconcile net income to net cash flow from operating activities: Changes in current operating assets and liabilities: Net cash flow from operating activities $ b. Cash flows from operating activities differs from net income because it does not use the of accounting. For example revenues are recorded on the income statement when .

Answers

Answer:

See answers below.

Explanation:

In order to get net cash flow through indirect method, we will have to make adjustment to the net income; hence we get the increase or decrease of different accounts with the data balance.

a) End beginning cash $48,030 $44,190

Increase in cash $3,840

Accounts receivable(net) $34,440 $32,660

Increase in accounts receivable $1,780

Merchandise Inventory $47,020 $49,710

Decreased inventory -$2,690

Prepaid expenses $5,280 $4,200

Increase prepaid expenses $1,080

Accounts payable(Merchandise creditors) $45,000 $41,800

Accounts payable increase $3,200

Wages payable $24,590 $27,310

Decreased wages payable -$2,720

Per below, we have some accounts that are added (+) to the net income while some are also deducted (-).

Net income $121,900

Adjustment to reconcile the net income to cash

+ Depreciation $20,100

+ Increase in cash $3,840

- Increase in accounts receivable ($1,780)

+ Inventory decrease $2,690

- Increase prepaid expenses ($1,080)

+ Accounts payable increase $3,200

- Decreased wages payable ($2,720)

Net cash $146,150

b) Briefly explain why net cash flow from operating activities is different other than net income.

The reason is that while net income refers to the earned profit by a company for a period ; cash flow from operating activities are measurement of daily cash (in and out) expended on business operation. Cash flow give explanation on the use of cash in an organization on a daily basis which includes net income from the income statement, changes in working capital, adjustments to net profits etc. t is to be noted that the starting point of calculating cash flow from operating activities is the net income.

State the effect (cash receipt or payment and amount) of each of the following transactions, considered individually, on cash flows:

a. Retired $300,000 of bonds, on which there was $3,000 of unamortized discount, for $312,000.
b. Sold 7,000 shares of $20 par common stock for $50 per share.
c. Sold equipment with a book value of $48,800 for $70,300.
d. Purchased land for $479,000 cash.
e. Purchased a building by paying $93,000 cash and issuing a $90,000 mortgage note payable.
f. Sold a new issue of $300,000 of bonds at 98.
g. Purchased 3,200 shares of $35 par common stock as treasury stock at $69 per share.
h. Paid dividends of $2.10 per share. There were 22,000 shares issued and 4,000 shares of treasury stock.

Answers

Answer:

a. Retired $300,000 of bonds, on which there was $3,000 of unamortized discount, for $312,000.

decrease cash flows from financing activities by $312,000

b. Sold 7,000 shares of $20 par common stock for $50 per share.

Increased cash flows from financing activities by $350,000

c. Sold equipment with a book value of $48,800 for $70,300.

increased cash flows from investing activities by $70,300, decrease cash flows from operating activities by $21,500 (= $70,300 - $48,800)

d. Purchased land for $479,000 cash.

decrease cash flow from financing activities by $479,000

e. Purchased a building by paying $93,000 cash and issuing a $90,000 mortgage note payable.

decrease cash flow from investing activities by $183,000, and increase cash flow from financing activities by $90,000

f. Sold a new issue of $300,000 of bonds at 98.

increase cash flows from financing activities by $294,000

g. Purchased 3,200 shares of $35 par common stock as treasury stock at $69 per share.

decrease cash flows from financing activities by $220,800

h. Paid dividends of $2.10 per share. There were 22,000 shares issued and 4,000 shares of treasury stock.

decrease cash flows from financing activities by $37,800

Choose the statement that is incorrect.
A. In the long​ run, a rise in the foreign price level brings dollar appreciation and a rise in the U.S. price level brings dollar depreciation.
B. In the long​ run, a change in the nominal exchange rate brings an equivalent change in the real exchange rate.
C. In the long​ run, the nominal exchange rate is a monetary phenomenon.
D. In the long​ run, the nominal exchange rate is determined by the quantities of money in two countries.

Answers

Answer:

B. In the long​ run, a change in the nominal exchange rate brings an equivalent change in the real exchange rate.

Explanation:

As we know that in the short run there is a decline in the nominal exchange that results in a decrease of real exchange rate due to which there is a reduction of the import and the export is risen.

But in the case of the long run, if there is a change in the nominal exchange rate so the real exchange rate would remain the same

This results that if there is a change in the nominal exchange rate so it would not bring the equal change in the real exchange rate

Hence, option B is incorrect

You are the newly assigned project manager to a major IT upgrade project in your global company. How will you determine the risk tolerances associated with your project

Answers

Answer:

I have to identify the risk factors in the project and then gauge the willingness of the company to take such risks.

Explanation:

Risk tolerance is the willingness of an organization or an individual to take certain risks. The risk tolerance level of a person or organization can be classified as either high or low. For a project manager who wants to determine the risk tolerances associated with his project, he has to first identify the risk factors, and then try to know the risk level and if indeed this level is acceptable within the organization's culture and standard.

The project manager would do well to plot a graph that would show the probability of a risky action happening or not. A risk tolerance line is now obtained from where the project manager can know if that risk is tolerable by organization standards. The extent of job security would also help in determining the amount of risk a manager can take. However, they are still expected to stay within the standards of the organization.

) A company finds that consumer demand quantity changes with respect to price at a rate given by D'(p) = - 2000 p 2 . Find the demand function if the company knows that 834 units of the product are demanded when the price is $5 per unit.

Answers

Answer:

D(p) = 2,000 ÷ Price + 434

Explanation:

The computation of the demand function is shown below:-

Number of units of the product = 3000 ÷ Price + C

834 = 2,000 ÷ $5 + C

834 = 400 + C

C = 834 - 400

C = 434

So, D(p) = 2,000 ÷ Price + 434

Therefore for computing the demand function we simply applied the above formula also we considered all the given information mentioned in the question

The rate of economic growth per capita in France from 1996 to 2000 was 1.9% per year, while in Korea over the same period it was 4.2%. Per capita real GDP was $28,900 in France in 2003, and $12,700 in Korea. Assume the growth rates for each country remain the same. 1. Compute the doubling time for France’s per capita real GDP. Use the rule of 72. 2. Compute the doubling time for Korea’s per capita real GDP. Use the rule of 72. 3. What will France’s per capita real GDP be in 2045? 4. What will Korea’s per capita real GDP be in 2045?

Answers

Answer and Explanation:

The rule of 72 refers the time period in which your investment which you invest should be doubled

So based on the rule of 72, the computation is shown below:

1. doubling time for France per capita real GDP is

= Rule of 72 ÷ rate

= 72 ÷ 1.9

= 37.89 years

2. Doubling time for Korea per capita real GDP is

= Rule of 72 ÷ rate

= 72 ÷ 4.2

= 17.14 years

3. France per capita real GDP in year 2045 is

= Per capita read GDP × (1 + growth rate)^time period

= $28,900 × 1.019^42

= $63,710.88

4. Korea  per capita real GDP in year 2045 is

= Per capita read GDP × (1 + growth rate)^time period

= $12,700 × 1.042^42

= $71,490.43

The time period 42 comes from

= 2045 - 2003

= 42 years

a proposed new project has projected sales of $222000, costs of $96500, and deperciation of $26100. The tax rate is 24 percent.Calculate operating cash flow using the four different approaches.

Answers

The question is incomplete. Here is the complete question

A proposed new project has projected sales of $222000, costs of $96500, and deperciation of $26100. The tax rate is 24 percent.Calculate operating cash flow using the four different approaches.

(Do not round intermediate calculations.)

A. EBIT+Depreciation-Taxes

B. Top-Down

C. Tax-Shield

D.Bottom-Up

Answer:

(A) $101,644

(B) $101,644

(C) $101,644

(D) $101,644

Explanation:

A proposed new project has a sales of $222,000

The cost is $96,500

The depreciation is $26,100

The tax rate is 24%

= 24/100

= 0.24

(A) Using the EBIT + Depreciation - Taxes approach, the operating cash flow can be calculated as follows

EBIT= Sales-Cost-Depreciation

= $222,000-$96,500-$26,100

= $99,400

Taxes= EBIT × tax rate

= $99,400 × 0.24

= $23,856

EBIT + Depreciation - Taxes

$99,400+$26,100-$23,856

= $125,500-$23,856

= $101,644

(B) Using the Top down approach, the operating Cash flow can be calculated as follows

Top down= Sales-Cost-Taxes

= $222,000-$96,500-$23,856

= $101,644

(C) Using the tax shield approach, the operating cash flow can be calculated as follows

Tax shield= (sales-cost)×(1-Tax rate)+(depreciation×tax rate)

= ($222,000-$96,500) × (1-0.24) + ($26,100×0.24)

= 125,500×0.76+6,264

= $101,644

(D) Using the bottom up approach, the operating cash flow can be calculated as follows

Bottom up = NI + depreciation

NI=EBIT-Taxes

= $99,400-$23,856

= $75,544

Bottom up=$75,544 + $26,100

= $101,644

A promotion related to the movie Pacific Rim Uprising was seen in Target stores throughout the United States. The sales promotion was designed to maximize the consumer's attention to a DVD release and provide storage for the products. This type of sales promotion is referred to as a

Answers

Answer:

This type of sales promotion is referred to as a Dealer Sales Promotion (Trade Promotion).

Explanation:

The Dealer Sales Promotion, otherwise known as Trade Promotion, is aimed at Dealers, designed to maximize the attention of consumers, and provide storage for the products in Target stores throughout the United States.  The promoters want Pacific Rim Uprising to be seen by consumers, so that their attention is galvanized, and to get Target stores to create the space for the DVD upon the film's release, through cooperative advertising.   It is not aimed directly at consumers or salespersons, but dealers.

Larry Nelson holds 1,000 shares of General Electric common stock. The annual shareholders meeting is being held soon, but as a minor shareholder, Larry doesn’t plan to attend. Larry did not sell his shares but gave his voting rights to the management group running GE. Larry must have signed a that gives the management group control over his shares. Larry also holds 2,000 shares of common stock in a company that only has 20,000 shares outstanding. Currently, the company’s stock is valued at $43.00 per share. The company needs to raise new capital to invest in its future production activities. The company is anticipating issuing 5,000 new shares at a price of $34.40 per share. Larry worries about the value of his investment. Larry’s current investment in the company is worth $ . If the company issues its new shares and Larry makes no additional investments in the company, then his investment will be worth $ . This scenario is an example of . Larry could be protected if the firm’s corporate charter includes a provision. If Larry exercises the provisions in the corporate charter to protect his stake, his investment value in the firm will become

Answers

Answer:

Larry must have signed a PROXY AGREEMENT that gives the management group control over his shares.

A proxy agreement is generally used for stockholders voting procedures, they basically grant another person the right to vote on behalf of another stockholder.

Larry's current investment in the company is $86,000.

= 2,000 stocks x $43 = $86,000

If the company issues new shares and Larry makes no additional purchase, Larry's investment will be worth $82,560.

company's new market value = (20,000 x $43) + (5,000 x $34.40) = $1,032,000

new stock price = $1,032,000 / 25,000 stocks = $41.28

= $41.28 x 2,000 = $82,560

This scenario is an example of STOCK DILUTION.

The stock price will lower because the increase in the company's value is less than proportional to the increase in the number of stocks.

Larry could be protected if the firm's corporate charter includes a PREEMPTIVE provision.

Preemptive rights give current stockholders the right to purchase more stocks (in case the company issues more stocks) before any outside investors.

If Larry exercises the provisions in the corporate charter to protect his stake, his investment value in the firm will become $103,200.

= [(5,000 / 10) x $34.40] + $86,000 = $17,200 + $86,000 = $103,200

The production budget shows expected unit sales of 40000. Beginning finished goods units are 3800. Required production units are 41600. What are the desired ending finished goods units

Answers

Answer:

desired ending inventory= 5,400 units

Explanation:

Giving the following information:

Sales= 40,000 units

Beginning finished goods= 3,800 units

Production= 41,600 units

To calculate the desired ending inventory, we need to use the following formula:

Production= sales + desired ending inventory - beginning inventory

41,600= 40,000 + desired ending inventory - 3,800

41,600 + 3,800 - 40,000= desired ending inventory

desired ending inventory= 5,400 units

The classical dichotomy is the separation of real and nominal variables. The following questions test your understanding of this distinction. Eleanor spends all of her money on paperback novels and mandarins. In 2012, she earned $27.00 per hour, the price of a paperback novel was $9.00, and the price of a mandarin was $3.00. Which of the following give the nominal value of a variable? Check all that apply. The price of a mandarin is 0.33 paperback novels in 2012. Eleanor's wage is 3 paperback novels per hour in 2012. The price of a mandarin is $3.00 in 2012. Which of the following give the real value of a variable? Check all that apply. The price of a paperback novel is $9.00 in 2012. Eleanor's wage is $27.00 per hour in 2012. The price of a paperback novel is 3 mandarins in 2012. Suppose that the Fed sharply increases the money supply between 2012 and 2017. In 2017, Eleanor's wage has risen to $54.00 per hour. The price of a paperback novel is $18.00 and the price of a mandarin is $6.00. In 2017, the relative price of a paperback novel is . Between 2012 and 2017, the nominal value of Eleanor's wage , and the real value of her wage . Monetary neutrality is the proposition that a change in the money supply nominal variables and real variables.

Answers

Answer:

In 2012, she earned $27.00 per hour, the price of a paperback novel was $9.00, and the price of a mandarin was $3.00. Which of the following give the nominal value of a variable? Check all that apply.

The price of a mandarin is $3.00 in 2012.

Nominal values are expressed in terms of current money. real variables are represented in terms of other goods or services.

Which of the following give the real value of a variable? Check all that apply.

The price of a paperback novel is 3 mandarins in 2012.

Nominal values are expressed in terms of current money. real variables are represented in terms of other goods or services.

Suppose that the Fed sharply increases the money supply between 2012 and 2017. In 2017, Eleanor's wage has risen to $54.00 per hour. The price of a paperback novel is $18.00 and the price of a mandarin is $6.00. In 2017, the relative price of a paperback novel is still 3 mandarins.  

Between 2012 and 2017, the nominal value of Eleanor's wage doubled, and the real value of her wage remained constant.

Monetary neutrality is the proposition that a change in the money supply affects nominal variables and does not affect real variables.

If a company has the following data, is the budget variance favorable or unfavorable? Budgeted Sales $10,000 Actual Sales. $8,000

Answers

Answer:

$2,000 unfavorable

Explanation:

The computation of the budget variance is shown below:

Budget variance is

= Budgeted sales - actual sales

where,

Budgeted sales is $10,000

And the actual sales is $8,000

Now placing these values to the above formula

So, the budget variance is

= $10,000 - $8,000

= $2,000 unfavorable

Since the actual sales is less than the budgeted sales so the same is to be unfavorable else it is favorable

Mr. Fred Mitchell is requesting the birth record for Amy, his birth daughter. Mr. and Mrs. Mitchell gave Amy up for adoption four years ago. Should you release the records to him? Why or why not? Yes or No

Answers

Answer:

"No" would be the correct choice.

Explanation:

The documentation could not be issued to him whenever their Amy is indeed not Mr. Mitchel's legal offspring attributable to some other individual's custody. They cannot compensate for the demand as well as text.Whether there is some doubt about either the approved note's authenticity, seek to contact the individual by contacting himself, either correlate signs on organizational documents.

A stock has a beta of 1.28, the expected return on the market is 12 percent, and the risk-free rate is 4.5 percent. What must the expected return on this stock be? (Do not round intermediate calculations and enter your answer as a percent rounded to 2 decimal places, e.g., 32.16.)

Answers

Answer:

Expected return on stock =14.1 0%

Explanation:

The Capital Asset pricing Model (CAPM) can be used to determined the expected return on the stock.  

According to the Capital Asset pricing Model the expected return on stock  is dependent on the level of reaction of the the stock to changes in the return on a market portfolio.

These changes are captured as systematic risk. The magnitude by which a stock is affected by systematic risk is measured by beta.  

Under CAPM, Ke= Rf + β(Rm-Rf)  

Rf-risk-free rate (treasury bill rate), β= Beta, Rm= Return on market, Ke-return on stock

Using this model, we can work out the return on stock as follows:

DATA

Ke-?

Rf- 4.5%

β-1.2 8

Rm- 12%

Ke = 4.5% + 1.28× (12-4.5)%=14.1 0%

Expected return on stock =14.1 0%

three different areas of life of VLOOKUP

Answers

Answer and Explanation:

The three different areas fo VLOOKup is as follows

1. The Primary key which is used for matching up your data for example, employee id, employee address etc

2. The list of lookup that represents the database i.e employees list who are working in an organization

3. the data which is required to match it or shifting the data

Answer:

I have identified the practical uses of VLOOKUP functions in the following three areas:

Education: A teacher with a list of student scores can use VLOOKUP to translate them to grades.

Sales: Sales managers can use VLOOKUP to determine the commissions their salespeople have earned.

Shopping: You can browse online catalogs for product listings and find their corresponding prices using VLOOKUP.

Explanation:

Suppose you invested in the Ishares High Yield Fund​ (HYG) a month ago. It paid a dividend of today and then you sold it for . What was your dividend yield and capital gains yield on the​ investment?

Answers

Complete Question:

Suppose you invested $100 in the Ishares High Yield Fund HYG your dividend yield and capital gains yield on the investment?

It paid a dividend of $2 today and then you sold it for $95. What was Dividend Yield and Capital Gains Yield on the investment?

Answer:

Dividend Yield is 2%

Capital Gains Yield is -5%

Explanation:

Dividend Yield:

We can calculate the Dividend Yield using the following formula:

Dividend Yield = D0 / Initial Stock Price

Here

D1 was Dividend paid just now and is $2 per share

Initial Stock Price before the dividend payment was $100 per share

By putting values, we have:

Dividend Yield = $2 per share / $100 per share = 2%

Capital Gains Yield:

We can find capital gains yield by using following formula:

Capital Gains Yield = (P1 - P0) / P0

Here

P1 is $95

P0 is $100

By putting values we have:

Capital Gains Yield = ($95 - $100) / $100 = -5%

Crazy Delicious Inc. produces chocolate bars. The primary materials used in producing chocolate bars are cocoa, sugar, and milk. The standard costs for a batch of chocolate (5,000 bars) are as follows: Ingredient Quantity Price Cocoa 500 lbs. $1.40 per lb. Sugar 100 lbs. $0.50 per lb. Milk 250 gal. $1.60 per gal.Required:Determine the standard direct materials cost per bar of chocolate.

Answers

Answer:

Unitary cost= $0.23 per unit

Explanation:

Giving the following information:

Standard costs (5,000 bars):

Cocoa 500 lbs. $1.40 per lb.

Sugar 100 lbs. $0.50 per lb.

Milk 250 gal. $1.60 per gal.

First, we need to calculate the total cost:

Total cost= 500*1.4 + 100*0.5 + 250*1.6

Total cost= $1,150

Now, the unitary cost:

Unitary cost= 1,150/5,000

Unitary cost= $0.23 per unit

The standard direct materials cost per bar of chocolate is $0.23 per bar.

First step is to calculate the total direct material cost for production of 5,000 bar of chocolate

Ingredient  Quantity Price Cost

Cocoa         500× $1.40 =$700

Sugar          100 ×$0.50 =$50

Milk             250 ×$1.60 =$400

Total                                $1,150

Second step is to calculate the standard material cost per bar of chocolate

Standard material cost per=$1,150/5,000

Standard material cost per=$0.23 per bar

Inconclusion the standard direct materials cost per bar of chocolate is $0.23 per bar.

Learn more here:https://brainly.com/question/22935766

Bandar Industries Berhad of Malaysia manufactures sporting equipment. One of the company’s products, a football helmet for the North American market, requires a special plastic. During the quarter ending June 30, the company manufactured 3,600 helmets, using 2,664 kilograms of plastic. The plastic cost the company $20,246. According to the standard cost card, each helmet should require 0.65 kilograms of plastic, at a cost of $8.00 per kilogram. Required: 1. What is the standard quantity of kilograms of plastic (SQ) that is allowed to make 3,600 helmets? 2. What is the standard materials cost allowed (SQ × SP) to make 3,600 helmets? 3. What is the materials spending variance? 4. What is the materials price variance and the materials quantity variance?

Answers

Answer and Explanation:

The computation is shown below;

1. The Standard quantity of kilogram for making 3,600 helmets is

= Number of helmets × number of kilograms required

= 3,600 × 0.65

= 2,340

2. The standard material cost is

= Standard quantity × standard price

= 2,340 × $8

= $18,720

3. Material spending variance is

= Plastic cost - standard material cost

= $20,246 - $18,720

= $1,526 unfavorable

4. The material price and quantity varaince is

Price variance

= Plastic cost - (number of plastic × cost)

= $20,246 - (2,664 × $8)

= $1,066 favorable

Quantity variance

= Standard Cost × (Actual quantity - standard quantity)

= $8 × (2,664 - 2,340)

= $2,592 unfavorable

Garfield Company has the following information for the current​ year: Beginning fixed manufacturing overhead in inventory $230,000 Fixed manufacturing overhead in production 850,000 Ending fixed manufacturing overhead in inventory 50,000 Beginning variable manufacturing overhead in inventory $40,000 Variable manufacturing overhead in production 140,000 Ending variable manufacturing overhead in inventory 30,000 What is the difference between operating incomes under absorption costing and variable​ costing?

Answers

Answer:

the difference between operating incomes under absorption costing and variable​ costing is $180,000 .

Explanation:

The difference between the two Operating Incomes lies in the amount of Fixed Overheads that has been deferred in Inventory.

So, calculation of the difference will be as follows :

Beginning fixed manufacturing overhead in inventory              $230,000

Less Ending fixed manufacturing overhead in inventory           ($50,000)

Difference  between  absorption costing and variable​ costing $180,000

Bella Pool Company sells prefabricated pools that cost $80,000 to customers for $144,000. The sales price includes an installation fee, which is valued at $20,000. The fair value of the pool is $128,000. The installation is considered a separate performance obligation and is expected to take 3 months to complete. The transaction price allocated to the pool and the installation is

Answers

Answer:

The transaction price allocated to the pool and the installation is $124,540.54 and  $19,459.46 respectively.

Explanation:

Price Allocation to Pool = $144,000 * (128,000 / (128,000 + 20,000))

Price Allocation to Pool = $144,000 * 0.864865

Price Allocation to Pool = $124,540.54

Price Allocation to Installation = $144,000 * (20,000 / (128,000 + 20,000))

Price Allocation to Installation = $144,000 * 0.135135

Price Allocation to Installation = $19,459.46

Innovative Products reported net income of $224,000. Beginning and ending inventory balances were $46,000 and $47,500, respectively. Accounts Payable balances at the beginning and end of the year were $38,000 and $34,000, respectively. Assuming that all relevant information has been presented, the company would report net operating cash flows of:

Answers

Answer:

$218,500

Explanation:

net operating cash flows = net income + adjustments

the adjustments include: depreciation expense (which is added), any increase in accounts receivables, inventory or prepaid expenses is subtracted, any increase in accounts payable or current liabilities is added.

net operating cash flows = $224,000 - ($47,500 - $46,000) + ($34,000 - $38,000) = $224,000 - $1,500 - $4,000 = $218,500

A company's board of directors votes to declare a cash dividend of $1.20 per share of common stock. The company has 24,000 shares authorized, 19,000 issued, and 18,500 shares outstanding. The total amount of the cash dividend is:

Answers

Answer:

$22,200

Explanation:

Shares is a method through which firms raise capital.

Authorised shares are the maximum number of shares a company can issue to investors

Outstanding shares are the total number of shares sold to investors . It is only outstanding shares that receive dividend payment.

Issued shares are the shares that a company issues

cash dividend = $1.20 x 18,500 = $22,200

2. The world has now become a “global village” in many respects. a) Explain any 5 factors working to make the world “a global village” for businesses. b) Discuss 4 major reasons why businesses go global.

Answers

Answer:

the watch has been totally fed tractors working to make a words a Glover villa for measures reserve between two globin respect as a global wind I have been by practice and a business discuss and white business as a work of the word for

Southtown Realty has entered into agency agreements with Sara, a seller and Tom, a buyer. Tom wants to make an offer on Sara’s home. Is this possible?

Answers

Answer: Yes it's possible as long as Tom and Sara gives a written consent to the dual agency arrangement.

Explanation:

From the question, we are informed that Southtown Realty has entered into agency agreements with Sara, a seller and Tom, a buyer. Tom wants to make an offer on Sara’s home.

This is possible as long as Tom and Sara gives a written consent to the dual agency arrangement.

As flextime, consulting, telecommuting, and downsizing make it more difficult for

people to donate blood at the workplace, Canadian Blood Services has launched a

CRM marketing campaign in Toronto to boost awareness and repeat donations.

Early in the campaign, it went to its listings of previous donors and pulled out

those with birthdays in February, March, and April. These donors were sent a

birthday card with the greeting, "On the anniversary of your life, would you

consider saving another's life?"

Refer to the scenario.


What technique did the organization use to analyze its donor information?

Answers

Answer:

The technique which the organization used in analyzing its donor is called Customer segmentation

Explanation:

Customer segmentation is the process of breaking large groups of customers into smaller, more homogeneous groups. This division are done specifically probably for marketing using attribute such as age, gender, interests and spending habits.

In the case of the CRM marketing campaign in Toronto, they inability to analyze all the data they had poses a challenge hence they reason why they segmented their customers according to their birthday. And customers are reached out according to those whose birthday falls nearby.

Research on women working in the corporate world indicates that one reason professional women leave their jobs is that the common corporate structure does not value:

Answers

Answer:

A. an interdependent worker.

Explanation:

Interdependent worker means the person who is handling the day to day operations of the business independently.

According to the given question, if the women are working in the corporate world than the chances of the leaving of their jobs is that the general corporate structure do not value them as an interdependent worker just because the person is a woman

Therefore the correct option is A

intext:"A company has net sales of $1,200,000 and average accounts receivable of $400,000. What is its accounts receivable turnover for the period"

Answers

Answer:

i think it would be 4x

Explanation:

im dumb

Informal groups: Group of answer choices exist primarily for the benefit of their members. perform routine organizational goals. perform uncommon tasks of the organization. always have a high level of interdependence. are initiated by the organization for special purposes.

Answers

Answer:

exist primarily for the benefit of their members.

Explanation:

Informal groups in an organization are created when individuals form a bond based on the experience that they share, they appear from friendship and not by rules inside the company but they influence how people interact and how they perform their job. Also, companies promote the apperance of these groups because they help people interact and improve their communication. According to that, the answer is that informal groups exist primarily for the benefit of their members as they are created by the friendship between employees and not by the company.

The other options are not right because informal groups don't perform routine organizational goals or uncommon tasks of the organization, they don't have a high level of interdependence and they are not initiated by the organization for special purposes because they are created by the employees and are not part of the company's structure.

Which of the following are assumptions of the sustainable (self-supporting) growth model? Check all that apply. The firm maintains a constant net profit margin. The firm’s liabilities and equity must increase at the same rate. The firm pays no dividends. The firm maintains a constant ratio of liabilities to equity.

Answers

Answer:

The firm maintains a constant ratio of liabilities to equity

Explanation:

At the beginning of the school year, Craig Kovar decided to prepare a cash budget for the months of September, October, November, and December. The budget must plan for enough cash on December 31 to pay the spring semester tuition, which is the same as the fall tuition. The following information relates to the budget: Cash balance, September 1 (from a summer job) $9,250 Purchase season football tickets in September 160 Additional entertainment for each month 250 Pay fall semester tuition in September 4,800 Pay rent at the beginning of each month 600 Pay for food each month 550 Pay apartment deposit on September 2 (to be returned December 15) 600 Part-time job earnings each month (net of taxes) 950Required:a. Prepare a cash budget for September, October, November, and December. b. Are the four monthly budgets that are presented prepared as static budgets or flexible budgets?c. What are the budget implications for Craig Kovar?

Answers

Answer:

a) Craig Novar's

Cash budget

                                                                  Months

                                        Sept.            Oct.             Nov.           Dec.

beginning balance          9,250         2,640          2,190           1,740

football tickets                -160

other entertainment       -250            -250            -250            -250

semester tuition             -4,800

rent                                  -600            -600            -600            -600

food                                 -550            -550            -550            -550

apartment deposit          -600                                                     600

part time jobs earnings   950             950             950             950

ending balance                2,640         2,190           1,740            1,890

b) This is a static budget because it is being prepared in advance. A flexible budget adjusts a static budget to the real cash outflows and inflows.

c) Since Craig is spending more money than what he earns, his cash balance is decreasing month by month. This tendency changes in December because Craig gets his apartment's deposit back, but he still will not have enough money to pay for Spring tuition.

Other Questions
HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity.