The energy from sunlight is directly used by the plant to
A. absorb carbon dioxide.

B. split water.

C. suck up water through the roots.

Answers

Answer 1

The energy from sunlight is directly used by the plant to :

=》split water molecules,

splitting of water molecules during photosynthesis is done by solar energy absorbed through chlorophyll.


Related Questions

A planet has less mass than a galaxy and more mass than the star it orbits.
True
False

Answers

Answer:

False is your answer

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

Deoxyribose (sugar). Total number in image?

Answers

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

The climate influences ________
A. Plant growth
B. Biodiversity
C. Adaptions of land organisms
D. All of the above

Answers

Answer:

D

Explanation:

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

What is meant by trophic levels?

Answers

Answer:

The position it holds in the food chain

Explanation:

A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

bacteria in nodules on the roots of plants before an important role in the _______ cycle.​

Answers

Nitrogen
Not 100% sure tho


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.

ITS C

Answers

Then answer is letter C

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

A limiting factor is a resource or other factor in the environment that can lower the population growth rate.

A. True
B. False

Answers

The answer is true.

What is another type of clean energy?

Answers

wind energy is a clean energy source

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

In at least 200 words explain how DNA replicates

Answers

Answer: Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Several enzymes and proteins then work together to prepare, or prime, the strands for duplication. Finally, a special enzyme called DNA polymerase organizes the assembly of the new DNA strands. The following description of this three-stage process applies generally to all cells, but specific variations within the process may occur depending on organism and cell type.

~i hope this helps :)

Answer:

QUESTION:

ANSWER:

Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. DNA replication is one of the most basic processes that occurs within a cell. Each time a cell divides, the two resulting daughter cells must contain exactly the same genetic information, or DNA, like the parent cell. To accomplish this, each strand of existing DNA acts as a template for replication.

The initiation of DNA replication occurs in two steps. First, a so-called initiator protein unwinds a short stretch of the DNA double helix. Then, a protein known as helicase attaches to and breaks apart the hydrogen bonds between the bases on the DNA strands, thereby pulling apart the two strands. As the helicase moves along the DNA molecule, it continues breaking these hydrogen bonds and separating the two polynucleotide chains

Meanwhile, as the helicase separates the strands, another enzyme called primase briefly attaches to each strand and assembles a foundation at which replication can begin. This foundation is a short stretch of nucleotides called a primer

After the primer is in place on a single, unwound polynucleotide strand, DNA polymerase wraps itself around that strand, and it attaches new nucleotides to the exposed nitrogenous bases. In this way, the polymerase assembles a new DNA strand on top of the existing one

Explanation:

A lot more than just 200 words sorry.

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!

Answers

Waning crescent- 6th one down

did you get the answer

What natural force is responsible for the formation of the cliffs by the ocean in the picture?

Answers

Answer:

i think that the wind is responsible

Answer: Erosion
Explanation: Cliffs are usually foreign because of processes called erosion and weathering. Weathering happens when natural events, like wind or rain, bricks of pieces of rock.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C
Other Questions
Which are solutions ofx/5= 1/+4?A. -5 and 1B. -1 and 5C. 0 and 5D. 0 and - 1E. 2 and 3 Cyanobacteria, also known as blue-green algae, are a kind of bacteria found in lakes. These organisms make their own food through photosynthesis. Small animals including mayfly larvae eat the cyanobacteria, and small fish such as yellow perch eat the larvae. The small fish provide food for larger fish, such as walleye.Choose the level of the food pyramid that represents the energy role of cyanobacteria in the lake ecosystem. 1. A/Anis a form of government in which citizenschoose their leaders by voting. According to federal dietary guidelines which of these foods is overconsumed?A) Green BeansB) Red MeatC) Whole GrainsD) Orange Vegetables how did lonnie johnson's accomplishments impact the general public This wish was granted two years later, following the 1974 season, when the Cleveland Indian's gave there managerial postto Frank Robinson, a Hall of Fame bound slugger who was then still an active player.Read the passage underlined (6). There may be a mistake in punctuation, capitalization, or spelling. If you find a mistake, choosethe answer that corrects the mistake. If there is no mistake, choose 'Correct as is.'A)Correct as is.B)when the Cleveland Indians gave their managerial post to Frank Robinson,a Hall of Fame bound sluggerwhen the Cleveland Indians gave there managerial post, to Frank Robinson,a Hall of Fame bound sluggerD)when the Cleveland Indians, gave their managerial post to Frank Robinson,a Hall of Fame bound slugger How did governments around the world respond to the Great Depression? dead cells are removed from the Dermis by phagocytosis. true or false? In a sale the normal price of a book is reduced by 30% what singles number must be i multiple by to reduce something by 30% I need help what is 23 7x + 6 + 8x = 26 What is 5g+7g and g(5+7)? 1. Which statement about the Russian constitution is true?a. It limits the power of the government.b. It states that people have freedom of speech.c. It prevents the right to education.d. It states that citizens cannot own their own houses. Refer to the Newsela article Opinion: From Embarrassed about Bicultural Identity to Celebrating It."Which statements convey an accurate assessment of the author's argument that people who are bicultural should use their experiences to educate others.Select two correct answers. A: The argument is adequately supported with examples from Indian culture that the author and her daughter have shared with others. B; The argument fails because the author only provides examples from her own cultural experiences for support. C: If the author had provided more information about what the government is doing to expand bicultural education, the argument would be more relevant.D; The author could have included statistics about how learning about different cultures benefits communities to strengthen the argument.Assessment navigation Seth bought glow-in-the-dark stars toput on his ceiling. There are 5 big starsand 25 little stars. He wants to makeconstellations that each have 1 bigstar. If he uses the same amount ofstars for each constellation, how manylittle stars will each have? What is 12 - 33/4 equal in fraction form? El bario worksheet Spanish 1 Tucker goes to bed at 8:25 pm everynight. He wakes up at 6:45 am. Howlong does Tucker sleep each night? The ratio of the number of games won to the number of games lost (no ties) by the Middle School Middies is 11/4. To the nearest whole percent, what percent of its games did the team lose? choose yes or no to tell if the fraction 2/9 will make each equation true81 x =18900 x = 20072 x =16450x = 100 Which 4 body sydtems interact to allow a person to sneeze