The energy from sunlight is directly used by the plant to :
=》split water molecules,
splitting of water molecules during photosynthesis is done by solar energy absorbed through chlorophyll.
A planet has less mass than a galaxy and more mass than the star it orbits.
True
False
Answer:
False is your answer
true or false
Photosynthesis is part of an oak tree's niche.
Answer:
True, veryyyyy true
:))
When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?
Answer:
Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.
Explanation:
Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.
Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.
What is antigen tests?An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.
Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.
To learn more about the Antigen click here
https://brainly.com/question/14453511
If a son has a sex-linked disorder, he received it from ______.
Answer:
tuff
Explanation:
Deoxyribose (sugar). Total number in image?
Answer:
Formula: C5H10O4
Molar mass: 134.13 g/mol
Solubility in water: Very soluble
Melting point: 91 °C (196 °F; 364 K)
Appearance: White solid
Classification: Pentose, Deoxy sugar
The climate influences ________
A. Plant growth
B. Biodiversity
C. Adaptions of land organisms
D. All of the above
Answer:
D
Explanation:
The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?
Answer:
No organisms
Explanation:
This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
What is meant by trophic levels?
Answer:
The position it holds in the food chain
Explanation:
A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
bacteria in nodules on the roots of plants before an important role in the _______ cycle.
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
dead cells are removed from the Dermis by phagocytosis. true or false?
Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea
Answer:
Yes.
Explanation:
Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.
Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.
ITS C
A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?
Answer:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
Explanation:
This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.
OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.
During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.
The fathers gene may be dominant due to environmental circumstances or other factors.
Answer:
Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
A limiting factor is a resource or other factor in the environment that can lower the population growth rate.
A. True
B. False
What is another type of clean energy?
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above
Answer:
The answer for this question is D
In at least 200 words explain how DNA replicates
Answer: Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Several enzymes and proteins then work together to prepare, or prime, the strands for duplication. Finally, a special enzyme called DNA polymerase organizes the assembly of the new DNA strands. The following description of this three-stage process applies generally to all cells, but specific variations within the process may occur depending on organism and cell type.
~i hope this helps :)
Answer:
QUESTION:
ANSWER:
Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. DNA replication is one of the most basic processes that occurs within a cell. Each time a cell divides, the two resulting daughter cells must contain exactly the same genetic information, or DNA, like the parent cell. To accomplish this, each strand of existing DNA acts as a template for replication.
The initiation of DNA replication occurs in two steps. First, a so-called initiator protein unwinds a short stretch of the DNA double helix. Then, a protein known as helicase attaches to and breaks apart the hydrogen bonds between the bases on the DNA strands, thereby pulling apart the two strands. As the helicase moves along the DNA molecule, it continues breaking these hydrogen bonds and separating the two polynucleotide chains
Meanwhile, as the helicase separates the strands, another enzyme called primase briefly attaches to each strand and assembles a foundation at which replication can begin. This foundation is a short stretch of nucleotides called a primer
After the primer is in place on a single, unwound polynucleotide strand, DNA polymerase wraps itself around that strand, and it attaches new nucleotides to the exposed nitrogenous bases. In this way, the polymerase assembles a new DNA strand on top of the existing one
Explanation:
A lot more than just 200 words sorry.
Hope that this helps you out! :)
If you have any questions please put them in the comment section below this answer.
Have a great rest of your day/night!
Please thank me on my profile if this answer has helped you.
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!
did you get the answer
What natural force is responsible for the formation of the cliffs by the ocean in the picture?
Answer:
i think that the wind is responsible
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron
