The Lok Sabha is usually elected once every five years

Answers

Answer 1

Answer:

The Lok Sabha is usually elected once every five years. The country is divided into numerous constituencies. Each of these constituencies elects one person to the Parliament. The candidates who contest elections usually belong to different political parties.


Related Questions

make a list of inventions and achievements made by Gehendra shumsher .​

Answers

Answer:

 Gehendra Shamsher is credited for modernization of Nepal Army. He was able to make his own mechanical machine gun similar to Gardner gun and named it Bira gun after his father. He is also credited for modifying Martini–Henry into new gun Gahendra Martini and Ge-rifle, a double-barrelled machine gun.

Gehendra Shumsher invented many objects such as Underground water extractor, mechanical machine gun, Bir gun, Gahendra rifle, and Ge-rifle, a double-barreled machine gun.

Dhir Shumsher, a canon Dhir-Gun modified.

Gehendra Shumsher (1871-1906) was a Nepalese military man who stood out for designing firearms, which has allowed him to be known as the first scientist of Nepal. Among the main invention of Gehendra stand out.

Underground water extractor.

Mechanical machine gun.

Bir gun.

Gahendra rifle.

Ge-rifle, a double-barreled machine gun.

Dhir Shumsher, a canon Dhir-Gun modified.

Learn more in: https://brainly.com/question/17186554

Generally, statutes and the case law governing franchising tend to emphasize the importance of Select and fair dealing in franchise relationships. This requires that the parties act Select and in good faith in fulfilling their contractual duties.

Answers

The franchise relationship is defined by the contract between the franchisor and the franchisee. The franchise contract specifies the terms and conditions of the franchise and spells out the rights and duties of the franchisor and the franchisee.

If either party fails to perform its contractual duties, that party may be subject to a lawsuit for breach of contract. If a fran-chisee is induced to enter into a franchise contract by the franchisor's fraudulent misrepresentation, the franchisor may be liable for damages. Generally, statutes and the case law governing franchising tend to emphasize the importance of good faith and fair dealing in franchise relationships.

Answer:

The Franchise Contract

Explanation:

The franchise contract is contract between the franchisor and the franchisee. It defines the terms and conditions as well as the rights and duties of both parties in the contract. Each party will be liable for damages if there is a breach of contract stemming from breach of duty or rights or terms of the contract. There are statutes and laws that govern franchising in most countries ensuring fair franchise contractual relationships

If ethical objectivism is true, then Group of answer choices the application of basic moral principles must be identical in all cultures and societies. the application of basic moral principles might vary among different cultures and societies. cultures and societies determine which basic moral principles are true. none of the above

Answers

Answer: the application of basic moral principles might vary among different cultures and societies.

Explanation:

Ethical Objectivism means that there are moral principles that are objective and universal and therefore valid for everybody. Such principles bind everyone together.

If ethical objectivism is true, the application of basic moral principles might vary among different cultures and societies.

Robin suspected that her roommate, Julie, wanted to break up with her boyfriend. Rather than asking her specifically, Robin paid close attention to how Julie complained about him, avoided his phone calls, and was late getting ready for dates with him. What method was Robin using to check her perception of Julie's feelings

Answers

Answer:

she was watching her in the form of spying

Clara thinks Carlo's idea for organizational outreach is impractical and cannot be implemented effectively. The discussion becomes heated and things seem to be getting out of control, so Chad suggests that the group take a break to rethink the issue. Chad is fulfilling which type of group role

Answers

Answer:

social role

Explanation:

Based on Chad's behavior in this scenario it seems that he is fulfilling a social role. These are any and all rights, duties, expectations, norms, and behaviors that a person has to face and fulfill involving those around you and their well being. Which is exactly what Chad is doing by making sure they take a break to relax, clear their heads, and get rid of some of their stress when things started to get tense in the group.

Which of the following is not part of the solution to overfishing the world's oceans? Monitoring fishing activities by satellite Using nets with smaller mesh to catch more fish Exploring alternative sources of income for fishers Restricting fishing boats to only a few days per month

Answers

Answer:

Using nets with smaller mesh to catch more fish is not a part of the solution to over fishing in the ocean.

Explanation:

Over fishing is when too many fish are being caught to maintain a healthy number. If you are using a net to catch more fish that just makes the problem any worse and i doesn't make sense.

In this, Using nets with smaller mesh to catch more fish is not part of the solution to overfishing the world's oceans. The correct option is (B).

What do you mean by the overfishing?

Except for overfishing, which occurs when boats catch fish more quickly than stocks can restock, fishing is not necessarily detrimental for the ocean.

Fish are caught at a rate called overfishing, which is higher than the rate at which they can reproduce to make up for what has been taken.

Many factors contribute to overfishing, including a lack of resources to implement laws, oversight, a lack of knowledge about fish populations, and a lack of coastal area protection.

Therefore, in this, Using nets with smaller mesh to catch more fish is not part of the solution to overfishing the world's oceans.

To know more about the overfishing, visit:

https://brainly.com/question/28579992

#SPJ2

Your text reveals that if one identical twin is gay, there is almost a 50 percent chance that the other identical twin will also be gay. On the other hand, if a fraternal twin is schizophrenic, there is only about a 20 percent chance the other fraternal twin will be schizophrenic. The measure of likelihood that twins will share this mental illness in common is called a(n)

Answers

Answer:

Concordance rate.

Explanation:

This can be defined to be a quantitative index of statistics that is been used by researchers in determining the relative influence of nature and nurture. Naturally, concordance is said to means 'to agree,' therefore concordance rate is explained to be rate of agreement. Formally, the concordance rate is the percent of cases in which both members of a pair have a particular attribute. Also in some cases, it is been seen to have relative influence of genes and environment on a mental illness, for example, the attribute is the particular mental illness, and the pairs studied are usually twins. Also in some studies that trades in line with identical twins result when a single fertilized egg splits into two eggs, and each egg develops into an embryo.

he ability of preschoolers to delay gratification has been found to be associated with: Group of answer choices All of the answers are correct. academic competence in high school. more self-reliant 10 years later. had higher-self esteem ~30 years later. were better able to delay responses on computer tasks ~40 years later.

Answers

Answer:

All of the answers are correct

Explanation:

According to the research conducted by the American psychologist Walter Mischel, it was concluded that the ability to delay gratification in early childhood has been found to be associated with a range of beneficial effects in adolescence and beyond.

These benefits include the following: tremendous academic competence and higher SAT scores, better body mass index, effective coping with pressure and anxiety social duty, and positive associations with counterparts, more self-reliant 10 years later, higher-self esteem 30 years later, and were better able to delay responses on computer tasks 40 years later.

Hence, given the options in the question, the right answer is "All of the answers are correct"

Researchers decide to find one customer who is willing to speak to them about their donut consumption. Apparently, this customer only started patronizing a certain café chain two months ago. Around the same time, she began experiencing migraine headaches. The researchers decide to do an in-depth analysis of this one case. What type of study is this? Case Study Prospective Cohort Cross-Sectional Correlational

Answers

Answer: Prospective

Explanation:

Religious ferment refers to religion that A. produced great excitement. B. was otherworldly or escapist. C. became despoiled and corrupted. D. touched more areas of society and touched them in more demanding ways. E. emphasized the irrational and emotional.

Answers

Answer: d. touched more areas of society and touched them in more demanding ways

Explanation:

Religious ferment could be described as when religion is used to address issues which breeds out sometimes violence and causes much problems but resolves the situation in some scenario's.

Nancy, aged 70, has a vacant plot adjacent to her house that she intends to bequeath to her grandson Roy upon her death. However, an important railroad project is being undertaken nearby and the local authorities have informed Nancy that the new railroad will cover her vacant lot. They have also promised her fair compensation in return. Can the government take her property?

Answers

Answer:

Yes, the government can take her property.

Explanation:

The government can take Nancy's property because it has eminent domain over the property. In other words, it means that the government can take private property and make it a public giving the owner compensation for the land. Besides, there has to be a public purpose for the eminent domain over the plot; which, could be the construction of roads, railroads, or public buildings.

what is women's rights​

Answers

Answer:

The rights which are given to the womans for the welfare , protection and d development of them are called women's rights.

Help fast plz!!!
The most complex level of culture is the culture trait.
Please select the best answer from the choices provided
ОТ
OF

Answers

Answer:

False.

Explanation:

Culture trait is the trait of any activity that is done by an individual that he acquires in his social life and transmitted through communication. This system of beliefs and traditions, the ideas and symbols learned by humans, are passed from one generation to the next.

This trait consists of any "manner" or "practice" that people learn and exhibit socially and is also transmitted to one another through various means of communication, which can be verbally or non-verbally. This form of a trait is not the most sophisticated or complex level of culture. Instead, it is the simplest level of culture.

An example of such trait is when you raise your glass to make a toast, and everyone joined in the "cheers".

Answer:

False

Explanation:

edge2021

It is this (i)___ characteristic, Dahl argues, that makes polyarchy the nearest possible approximationto the democraticideal. Polyarchy achieves this diffusion of power through party (ii)___ and the operation of pressure groups. Competing for votes, parties seek to offer different sections of the electoratewhattheymostwant;theydo not ask whatthe(iii)___thinksofan issue, but what policy commitments will sway the electoral decisions of particulargroups.

Answers

Answer:

1.  Centrifugal

2.  Competition

3.  Majority

Explanation:

This is an excerpt from a political science-oriented book written by Robert A. Dahl.

It is this CENTRIFUGAL characteristic, Dahl argues, that makes polyarchy the nearest possible approximation to the democratic ideal. Polyarchy achieves this diffusion of power through party COMPETITION  and the operation of pressure groups. Competing for votes, parties seek to offer different sections of the electorate what they most want; they do do not ask what the MAJORITY thinks of an issue, but what policy commitments will sway the electoral decisions of particular groups.

What agreement was come to at the Yalta Conference regarding Germany? A. Germany would no longer be able to form a military B. Germany would be left entirely alone with no punishment C. Germany would temporarily be occupied by the victors D. Germany would lose over half of its territory

Answers

Answer:

The agreement come to at the Yalta Conference was:

C. Germany would temporarily be occupied by the victors.

Explanation:

President Franklin D. Roosevelt, British Prime Minister Winston Churchill and Soviet Premier Joseph Stalin met in 1945 to discuss and decide the fate of defeated Germany. They agreed to temporarily occupy Germany's territory, dividing it into three post-war occupation zones. It was also agreed that France would get an occupation zone as well, its territory being taken from the American and British ones - that condition was imposed by Stalin. It was also determined that Germany should take responsibility for post-war reparations, but not on its own.

what fears were raised during the early period of federal discussion in Nepal​

Answers

Answer:

Federal discussion in Nepal refers to the system government power divided by that central power and political units.

Explanation:

Nepal is a geographical diversity country , federal discussion government at central level and that state level.

The state government power to the made federal law and that a maintain a law in the order in state,Nepal government power of the territorial integrity to run a government project.

Federal discussion has transformed into a social and religious discrimination the country.

Federal discussion is a dual government nation system.

Nepal is the officially as the federal democratic republic of Nepal, as the future of the new Nepal.

Nepal is the declared in a Hindu nation, government under at the shah rules.  

how did ancient Greek and roman texts contribute to the rise of humanism in ltay

Answers

Answer: they introduced Italian scholars to academic fields that promoted individual growth and thinking.

What is the definition of democracy by Abraham Lincoln​

Answers

Answer:

The government of the people, for the people, and by the people.

Explanation:

It is a political system in which the supreme power lies in somebody of citizens which are elected by the citizens of that country through lawful voting.

According to control theory everyone is propelled towards deviance, but that two control systems work against these motivations to deviate. How some people in the Pakistan feel that if criminals were given job skills while in prison, then those particular criminals would not repeat their criminal behavior? Explain.

Answers

Answer:

Norms are the social rules that govern behavior in a community. Norms can be explicit (such as laws) or implicit (such as codes of polite behavior). Norms can be difficult to identify because they are so deeply instilled in members of a given society. Norms are learned by growing up in a particular culture and can be difficult to learn if one does not grow up in the same social milieu.

The act of violating a social norm is called deviance. Individuals usually have a much easier time identifying the transgression of norms than the norms themselves. For example, few Americans would think to tell a sociologist that it is a social norm to hold the door open for a fellow pedestrian entering a building if within a particular distance. However, someone might remark that another person is rude because he or she did not hold the door open. Studying norms and studying deviance are inseparable endeavors.

How would you describe the physical geography of Georgia?

Answers

Answer:

Northern Georgia is covered by the southern edges of the Appalachian Mountains. The heavily forestand Blue Ridge Mountains, famed for a bluish color when seen from a distance, form the eastern front of the Appalachians from Georgia to Pennysylvania. The state's highest point is located here, Brasstown Bald at 4,784 ft.

(i got this from google)

A new client tells you that he was an avid tennis player before he hurt his back a year ago. He often thought about it when he would bring his son to tennis lessons. Now that he no longer has symptoms, he is ready to get in shape for tennis. Based on the sequence of these events, what was the progression for the stages of change?

Answers

Answer: action; precontemplation; action

Explanation: The stages of behavioral change exhibited in the scenario described above include the action stage which is the most obvious stage of behavioral change whereby implementation of strategy, plans, experience are put into use, being an avid tennis player he was actively preforming the sport. After this, precontemplation occurs which describes the period whereby he had a compulsory unplanned break from the sport due to injury. Then the action stage again which occurs after recovering from injury and getting back into active performance of his favored sport.

On Monday, Johnny's mother gave him cookies and milk after he had played quietly for 10 minutes. On Tuesday, she required 20 minutes of quiet play before treat time, and on Wednesday, the cookies were given to him only after a full half hour of quiet play. Johnny was taught to play quietly for extended periods through:________.
a. modeling.b. latent learning.c. partial reinforcement.d. shaping.

Answers

Answer:.d. shaping.

Explanation:

Shaping, also referred to as " successive approximations "is the step by step systematic reinforcement of a target behavior, of which each step brings one closer until that target desired behavior is achieved,

Here, the trainer's role is to ensure  assistance and guidance to his or her subject in setting goals to achieve a desired behavior.

Shaping even though employed in the training of domestic pets lie dogs, cats etc have been efficiently used to reinforce desired behavior in human especially at an early age, In the question above,, we can see that Johnny's mother used a step by step successive approach to Shape Johnny  to a desired behaviour.

Tommy has obsessions about cleanliness and is a compulsive handwasher. Which of the following pieces of evidence would support the view that his obsessive-compulsive disorder is related to operant conditioning?

a. Although his parents have punished Tommy many times for handwashing, he continues to engage in the behavior.
b. Tommy sees his brother engage in compulsive handwashing, so he also engages in the behavior.
c. Tommy experiences a large reduction in anxiety whenever he washes his hands, so he continues the behavior whenever he becomes anxious.
d. Tommy read a sign saying that handwashing helps prevent illness.

Answers

I think C but I’m not 100% sure

Tommy experiences a large reduction in anxiety whenever he washes his hands, so he continues the behavior whenever he becomes anxious that piece of evidence would support the view that his obsessive-compulsive disorder is related to operant conditioning. The correct option is C.

What is the root cause of OCD?

Experts are uncertain of OCD's precise cause. The environment, genetics, and anomalies of the brain are regarded to be contributing factors. It frequently begins in adolescence or early adulthood. However, it can also begin in infancy.

Anxiety is a symptom of obsessive-compulsive disorder (OCD), a psychiatric condition. Obsessions that are an uncontrollable plague, someone, with OCD fears, thoughts, or urges. Through compulsions, which are repetitive behaviors, they attempt to reduce anxiety. OCD disrupts daily living and causes distress.

Thus, the ideal selection is option C.

Learn more about obsessive-compulsive disorder here:

https://brainly.com/question/13956929

#SPJ6

what was the language of administration under the delhi sultanate​

Answers

Answer:

The language of administration under the Delhi Sultanate is Persian language.

Explanation:

The Delhi Sultanate is all they Islamic empire and the Indian subcontinent for the 320 years, and his religion is Sunni Islamic.

Delhi Sultanate is ruled over by among number a ruled by Turkic generals of Muhammad, both of the Sultanate is reaches only  by the geographical dynasty of Indian sub continent.

Delhi sultanate is in India part of affecting to the Asian continent, the whole southern and western Asia, many of the Muslim rules  in rival states an non Muslim and central Asian steppes.

The impact of Islam on the sub continent one must by the northwestern subcontinent, raiding from central Asia in Islamic  era .

Sunni Islamic  kingdom his extending to the  river laid the foundation for Muslim kingdom, called Delhi Sultanate from 1191 to the geographical  claims.

Delhi Sultanate a succession of weak rules Muslim and short lived tenures,banned socialization among as well as inter marriage families, he cut salaries poets, officials and scholars.  

An agent of a broker-dealer is opening a new client account. The agent has completed the new account application and the suitability determination. The customer has an investment objective of safety of principal and income. The agent makes an initial recommendation of a conservative blue chip stock with a track record of paying a consistent cash dividend. The customer accepts the recommendation. When must the commission charged on the transaction be disclosed to the customer?A. At the time that the order is placedB. At the time when the order is filledC. At the time when the account is openingD. On the confirmation of the transaction

Answers

Answer:

option D. On the confirmation of the transaction

Explanation:

in business transaction, there is no rule or requirement  for disclosure of the  commission charged to customers at the time of the trade or at the time of account opening. it is only after the confirmation of the transaction  can it be disclosed. that is,  the only requirement is that the commission be disclosed on the trade confirmation. Also remember that any commission charged must be "fair and reasonable."

All the religions are same,but the different is their name . Justify

Answers

Answer:

All the religions are same but different names like Islam, Christianity, Hinduism etc. All the religions believe in god. Muslims call him Allah, Christians call him God, Hindus call him Bhagwan. All religions tell people to be grateful, to be kind, to not take revenge on someone, to help others, to pray, to not commit sins. All the religions tell us about heaven and hell and that the life on earth is temporary. Every religion tell us to cover ourselves with enough amount of clothing, every religion tells us to respect other religion, to not judge a person based on their religion. Every religion tells us that there is an Angel of Death and God can do whatever he wants and God is the most powerful, that god is one. Every religion tells us to not fight with one another. All the religions tells to seek forgiveness.

Explanation:

Veronica spent three years fighting cancer before dying. As a result of her prolonged death, her husband, Nelson, prepared emotionally for it and acknowledged that the loss was inevitable. Nelson engaged in __________.

Answers

Answer: Anticipatory grieving

Explanation: When an event is being anticipated, it simply means an event that has been coming or one which an individual is expectant of. In the scenario above, Veronica who happens to be Nelson's wife was plagued with cancer which happens to be a sort of terminal disease. Due to the nature of the disease and prolonged length of her death, Nelson was already planning or predicting the death of Veronica as he has doubts over her survival. The emotional Preparedness which Nelson made over his wife's death is called anticipatory grieving.

Mention any five ways to preserve our art, religion and culture.​

Answers

1.The Exhibition
2.Awareness seminars
3.Workshops
4.Exhibitions and fairs
5.Live performances

Answer:

Regular practice and knowledge sharing

Live performances

Exhibitions and fairs

Workshops

Awareness seminars

Explanation:

National Association of Social Workers, Council on Social Work Education, and the International Federation of Social Workers all endorse a(n) _____-oriented view of social work.

Answers

Answer:

empowerment

Explanation:

These organizations the International Federation of Social Workers (IFSW) and the National Association of Social Workers (NASW) is known for its empowerment-oriented view of social work.

In other words, they believe that social work can liberate enhance people's well-being.

Barkley and Timothy are engaged in a debate about child abuse.Barkley opines that white children are more likely to suffer from abuse.However, Timothy disagrees and argues otherwise.He opines that children belonging to minority groups are more likely to suffer from abuse.Which of the following is an accurate statement that strengthens Barkley's argument?
A) Typically, most minority groups have close family ties and are less likely to physically or emotionally chastise their children.
B) Latino families have a lower percentage of child victimization than their white counterparts.
C) Unlike whites, African American families do not believe in disciplining children physically.
D) Despite being more prevalent among minority groups, child maltreatment percentages are higher among whites.

Answers

Answer:

D) Despite being more prevalent among minority groups, child maltreatment percentages are higher among whites.

Explanation:

It is said that Barkley and Timothy are engaged in a debate about child abuse.Barkley opines that white children are more likely to suffer from abuse.However, Timothy disagrees and argues otherwise.He opines that children belonging to minority groups are more likely to suffer from abuse.

The option which strengthens Barkleys stance on the subject is that Despite being more prevalent among minority groups, child maltreatment percentages are higher among whites.

Other Questions
HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity.