the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer 1

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.


Related Questions

Marsupials, like kangaroos, are found mainly in ____.
A. North America

B. Europe

C. South America

D. Australia

Answers

Answer:

D Australia

Explanation:

I already know this

Answer:

Hi, there the answer is D. Australia

Explanation:

What would happen to aquatic organisms if solid water were denser than liquid water

Answers

Answer:

If water in its solid form was denser than water in its liquid form, lakes and ponds would freeze solid to the bottom during winter, and no longer provide viable habitats.


What is the name of a network of interconnected food chains showing the energy flow through an ecosystem?

Answers

Answer:

Food web

Explanation:

Where in the digestive system might 2 protease enzymes be produced?????

Pls help

Pls
Please me give all my points

Answers

Explanation:

Proteases

Region of digestive system Enzyme Where produced

Stomach Protease - pepsin Gastric glands in stomach

Small intestine - Duodenum Protease - trypsin Pancreas

Small intestine - Ileum Protease - peptidase Wall of ileum

Kingdoms are a more specific (less broad) category in the taxonomic hierarchy.
A. True

B. False

Answers

true helpful answer to your question

Answer:

false

because if you actually order the levels of classification from MOST specific to LEAST specific, kingdom would be somewhere last.

Luminosity has do with brightness of a star. It's essentially the power of the star, or how light is being emitted from the surface. About how much brighter is Antares than the Sun

Answers

The brightness of Antares at visual wavelengths is about 10,000 times that of the Sun, but because the star radiates a considerable part of its energy in the infrared part of the spectrum, the true bolometric luminosity is around 100,000 times that of the Sun.

8. Which observation would be the best evidence to use to argue that there is an evolutionary relationship between two species?

They occupy the same niche.

They have similar fur color.

They have similar DNA base sequences.

They inhabit the same geographic regions.​

Answers

Answer: C: They have similar DNA base sequences

Explanation:

somebody pls pls help

Answers

Answer:

A

Explanation:

Replanting trees on a bare hillside is an EXAMPLE of

Answers

Answer:

Reforestation and restoration

Answer:

Reafforestation and restoration

hope it helps

Which is associated with weak light rays that travel in different directions?

Answers

Answer:

"scattering" that would be the correct answer :)

Explanation:

hope it helps

What type of energy makes wind blow out towards the water at night

Answers

Answer:

kinetic energy

The wind is energy in motion—kinetic energy—and it is a renewable energy source

Fungi live by
A. Making their own food.

B. Eating other organisms.

C. Sucking up nutrients made by other organisms.

Answers

Answer:

C

Explanation:

Fungi are heterotrophic.

Fungi are not able to ingest their food like animals do, nor can they manufacture their own food the way plants do. Instead, fungi feed by absorption of nutrients from the environment around them. Most fungi are saprophytes, feeding on dead or decaying material.

Answer:

C. Sucking up nutrients made by other organisms.

Explanation:

Fungi (singular: fungus) are a kingdom of usually multicellular eukaryotic organisms that are heterotrophs (cannot make their own food) and have important roles in nutrient cycling in an ecosystem.

It could be other plants or animals where they get a great place to source their food.

During this time, the fungi kind of hibernates until they get a suitable and beneficial place they can transfer to.

In Guinea pigs black fur(B) is
dominant over white (b). What is the
phenotype of the offspring if one
parent is BB and the other is bb?
E. BB
F. Bb
G. Black
H. White

Answers

Answer:

Explanation:

F

Explain in at least five sentences what you've learned about how
global warming and climate change are impacting our Earth in different regions of the world.

Answers

Explanation: I'd first address the issue as a whole and explain the meaning and the general impacts of climate change, then use a variety of different places. For example, global warming causes the ice caps to melt in Antarctica. Then, explain how this has an impact on the environment meaning that polar bears could be in life-threatening situations and possibly even become extinct in the future which has a further impact on other animals in that food chain and ecosystem. This is just one example. You could also explain the unbearable heat in countries nearer the equator, which prevent crops from growing; the sea levels rising; or extreme weather events like huge flooding or heatwaves. It depends what you have learnt about in class, but I'm assuming it would be about this sort of thing.

Answer:

Higher death rates. ...

Dirtier air. ...

Higher wildlife extinction rates. ...

More acidic oceans. ...

Higher sea levels.

hope it helps

The punctuated equilibrium model of evolution agrees with the theory of gradualism
on the idea of

a) inheritance of acquired characteristics
b) natural selection
c) use and disuse of organs
d) the rate of speciation

Answers

Natural selection. They disagree on the rate, inheritance, and whatever c is talking about.

Drag each tile to the correct location. Plants need to perform the processes of photosynthesis and cellular respiration. Label the model to show these processes.

Answers

You said label where is the diagram?

This process of protein synthesis occurs similarly in most organisms due to the fact that it is the same universal ____ molecule that contains the instructions for it.
A. DNA

B. RNA

Answers

Answer:

A. DNA

Explanation:

This process of protein synthesis occurs similarly in most organisms due to the fact that it is the same universal DNA molecule that contains the instructions for it. So, option (A) is the correct answer.

62.5 milligrams into grams

Answers

Explanation:

62.5 = 0.0625 g

your answer is like this

The diagram below summarizes an important process.
Mpho
Which process does the diagram summarize?
Interphase
O A. The Calvin cycle
B. Meiosis
O C. Mitosis
O D. The cell cycle

Answers

Can’t see a diagram.

Answer:

The cell cycle

Explanation:

is Turner syndrome an autosomal recessive gene?

Answers

Answer:

No, it's dominant.

Explanation:

It is an autosomal dominant genetic disorder and is not a chromosomal disorder.

Answer:

NO!  

Explanation:

It is an autosomal dominant genetic disorder and is not a chromosomal disorder.  Turner syndrome (TS), sometimes referred to as congenital ovarian hypoplasia syndrome, is a genetic disorder. It is the most common sex chromosomal abnormality affecting girls and women. More specifically, it's a problem with one of the two X chromosomes -- the thread-like structures inside cells that are made of DNA.

Which layer of the atmosphere protects all life on land by absorbing high energy radiation?

Answers

Answer:

The troposphere layer.

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

Please HELP!!!
Which of the following best describes an organ system?

A. One or more cell types that perform specific functions
B. Various cells that perform different functions
C. Two or more tissues organized and capable of carrying out a specific task
D. Two or more organs that interact to perform a common task

Answers

Answer:

D

Explanation:

PLs, help me with this biology question

Answers

Answer:

1. mRNA

2. translation

3. Proteins

Biological knowledge is important in all of the following except

Answers

Answer:

both a body of knowledge and an intellectual activity encompassing observation, description experimentation, and explanation of natural phenomenon.

Explanation:

Magnetic __?_______ don't exist.

Answers

Answer:

Those materials which are not attracted by a magnet are called non- magnetic materials. All the substances other than iron, nickel, and Cobalt are non-magnetic substances for example plastic, rubber, water, etc are nonmagnetic materials. Non-magnetic substances cannot be magnetized.

Which of the following is a characteristic of invasive species?

Answers

Answer:

They Take resources from native species

Explanation:

An invasive species doesnt grow slowly, they do the opposite they grow super fast becaus ethey are the best out of the others and completly own the place.

The can adapt or they aren't considered invasive, that's why they are so effective

They aren't endangered or else its not invasive, they are thriving because they have 0 competition.

Give brainliest pls

Because of their capacity for rapid growth and reproduction, or because their new environments are devoid of any native predators or pests, invasive species frequently thrive in their new ecosystems. Thus, option B is correct.

What is a characteristic of invasive species?

An invasive species doesn't develop slowly; on the contrary, they accelerate their growth because they are superior to all other species and have taken over the area completely.

Because of this, invading species may pose a threat to native species and interfere with crucial ecosystem processes.

A species must be easily adaptable for it to be invasive. It needs to multiply swiftly. It must result in harm to local property, the local economy, or the local fauna and flora. Accidental introduction of invasive species into a new area is common.

They are so successful because they can adapt and aren't intrusive. Because they have no competition, they are thriving while not being threatened.

Therefore, They take resources from native species.

Learn more about invasive species here:

https://brainly.com/question/20022845

#SPJ2

which gland will need to produce hormone after eating banana?

A. pituitary gland

B. thyroid

C. adrenal glands

D. Pancreas​

Answers

Answer:

thyroid

Explanation:

Right after we eat a sugary meal, the glucose levels in our blood begin to rise. Conversely, if we haven't eaten for a couple of hours our blood glucose levels begin to drop. Our body has a mechanism whereby it maintains blood glucose levels.

Label the male reproductive system. ​

Answers

Answer:

Refer the attachment!!!

What is the genotype of an organism?

A. The genotype is the DNA sequences of this gene on a homologous pair of chromosomes.

B. How the genes are expressed resulting in the physical appearance of the organism.

Answers

Answer:A. The genotype is the DNA sequences of this gene on a homologous pair of chromosomes.

Explanation:

A. The genotype is the DNA sequences of this gene on a homologous pair of chromosomes.

Other Questions
look at pic 10 pts will mark brainilest AND WILL HELP OUT W A QUESTION shsu A company is considering the purchase of a new machine for $48,000. Management expects that the machine can produce sales of $16,000 each year for the next 10 years. Expenses are expected to include direct materials, direct labor, and factory overhead totaling $8,000 per year plus depreciation of $4,000 per year. All revenues and expenses except depreciation are on a cash basis. The payback period for the machine is 12 years. True False What is the solution of the system of equations graphed below? The box plots below show the math scores of students of two different classes, which statement is correct 7 changes that were made to the public holiday heritage day which of the following is a property of acidsA. they are slipperyB. They taste bitterC. They react with oilsD. they are sour A set of charged plates isseparated by 8.08*10^-5 m. When2.24*10^-9 C of charge is placedon the plates, it creates a potentialdifference of 855 V. What is thearea of the plates?(The answer is _*10^-5 m^2. Just fillin the number, not the power.) if 3 /5 of a class read 4 or more how man students read three books what is the value of x. The NIMS Management Characteristic of Chain of Command and Unity of Command means that each person: The illegal activicty is a conspiracy to boycott a firm and drive it out of business. This is know as? Which explicit formula is equivalent to a1 = 1, an=4an-1?A. an = 1(4)^n-1B. an = 4(4)^n-1C. an = 4(1)^n1D. an = 1 + (n - 1)4 Tony is building a new silo to store corn as animal feed. It will be a cylinder topped with a half-sphere, and must store 21 000 t of corn. The entire silo can be filled with corn. Tony wants to minimize the surface area of the silo to reduce materials and paint costs. He has the following information: 1 cubic m of corn has a mass of 700 kg. Building costs are $8/m2, taxes included. Paint comes in 3.8 L cans. Each can covers 40 sq m and costs $35, taxes included. Corn costs $140 per tonne ($140/t), taxes included. What is the total cost to build, paint, and fill a silo with the least surface area? 5. What process happens when rocks break down due to reaction with water,carbon dioxide, oxygen and organic acids?A. Biological EngineeringB. Chemical EngineeringC. Electrical EngineeringD. Mechanical EngineeringIf your score issted by the ever4- 5 Very good! You may still read the module but you are alreadyknowledgeable with the topics that we are to discuss.2-3 Good! Go over the items that you find difficult and then you may proceedto the lessons in this module that you don't understand. .to Use the information provided in the journal entry to post the transaction to the t-account. Post in DR/CR order.Date Accounts and Explanation Debit Credit Nov. 1 Cash 45,000 Common Stock 45,000 Received cash from selling shares of stock Date Accounts and Explanation Debit Credit Nov. 4 Truck 21,200 Notes Payable 21,200 Bought a compary truck by signing Date Accounts and Explanation Debit Credit Nov. 8 Salaries Expense 14,500 Cash 14,500 Paid cash for salaries ,500 Date Accounts and Explanation Debit Credit Nov. 12 Office Supplies 9,200 Accounts Payable 9,200 Purchased office supplies on account Date Accounts and Explanation Debit Credit Nov. 13 Cash 7,500 Unearned Revenue 7,500 Collected cash for future services Date Accounts and Explanation Debit Credit Nov. 12 Office Supplies 9,200 Accounts Payable 9,200 Purchased office supplies on account Date Accounts and Explanation Debit Credit Nov. 13 Cash 7,500 Unearned Revenue 7,500 Collected cash for future services system. Construct an ER diagram for keeping records for exam section of a college. Help................... so I will pay pal $45 you if your welling to do all my social studies assignments Identify the angle or side that is common to SUT and SVT. plzz help I will mark brainliesttttt