Engineering High School

The yellow rectangle area is 25% (or 1/4) the area of the blue rhombus. The height (H) of the yellow rectangle is twice as long as the base of the yellow rectangle. Calculate the required height (H) of the yellow rectangle. Round to nearest one decimal (tenths) place. (Precision 00.0)​

The Yellow Rectangle Area Is 25% (or 1/4) The Area Of The Blue Rhombus. The Height (H) Of The Yellow

Answers

Answer 1

Answer:

I don't know sry

Explanation:

Related Questions

What kind of safety technology can Sam use for genetically modified crops?
Sam needs to use some technology as a safety measure to prevent genetically modified crops from spreading beyond the area they are planted in. He can use the
technology to make the seeds of genetically modified plants sterile.

Answers

Answer:

genetic modification technology allows the transfer of Genes for specific traits between species using laboratory techniques. the substance that protects GMO crops which are called plant Incorporated protectants (PIP) and work to give the crops resistance to inspect and disease

What classification is an E7018?

will give brainliest

Answers

Answer: E7018 is a low-hydrogen iron powder type electrode that produces high quality x-ray welds. It can be used in all positions on AC or DC reverse polarity welding current.

Explanation: Hope this helps

True or false - When electrons collect in a specific object, that object gains a negative static charge.

Answers

When electrons collect in a specific object it would be False

Answer:

Its false.

Explanation:

Other Questions
A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place).