They did a flu shot from McKinnon at 45° to the horizontal with an initial speed of 25 m/s and that is positioned at a horizontal distance of 50 m from the canyon from which it is shot how long does it take the daredevil to travel the 50 m horizontally

Answers

Answer 1

Answer:

The time taken for the daredevil to travel the 50 m horizontally is 2.83 s.

Explanation:

Given;

angle of projection, θ = 45°

initial speed of the projectile, u = 25 m/s

horizontal distance traveled by the projectile, x = 50 m

The time taken for the daredevil to travel the 50 m horizontally is calculated as;

[tex]t =\frac{X}{u_x}[/tex]

where;

[tex]u_x[/tex] is the horizontal component of the velocity = uCosθ

[tex]t =\frac{X}{u Cos \ \theta} \\\\t =\frac{50}{25 \times Cos(45)} \\\\t= \frac{50}{17.678} \\\\t = 2.83 \ s[/tex]

Therefore, the time taken for the daredevil to travel the 50 m horizontally is 2.83 s.


Related Questions

is cereal a soup? explain why or why not

Answers

Answer:

no

Explanation:

because its cold

soup is hot

Glider‌ ‌A‌ ‌of‌ ‌mass‌ ‌0.355‌ ‌kg‌ ‌moves‌ ‌along‌ ‌a‌ ‌frictionless‌ ‌air‌ ‌track‌ ‌with‌ ‌a‌ ‌velocity‌ ‌of‌ ‌0.095‌ ‌m/s.‌ ‌It‌ ‌collides‌ ‌with‌ ‌glider‌ ‌B‌ ‌of‌ ‌mass‌ ‌0.710‌ ‌kg‌ ‌moving‌ ‌in‌ ‌the‌ ‌same‌ ‌direction‌ ‌at‌ ‌a‌ ‌speed‌ ‌of‌ ‌0.045‌ ‌m/s.‌ ‌After‌ ‌the‌ ‌collision,‌ ‌glider‌ ‌A‌ ‌continues‌ ‌in‌ ‌the‌ ‌same‌ ‌direction‌ ‌with‌ ‌a‌ ‌velocity‌ ‌of‌ ‌0.035‌ ‌m/s.‌ ‌What‌ ‌is‌ ‌the‌ ‌velocity‌ ‌of‌ ‌glider‌ ‌B‌ ‌after‌ ‌the‌ ‌collision?

Answers

Answer:

vB' = 0.075[m/s]

Explanation:

We can solve this problem using the principle of linear momentum conservation, which tells us that momentum is preserved before and after the collision.

Now we have to come up with an equation that involves both bodies, before and after the collision. To the left of the equal sign are taken the bodies before the collision and to the right after the collision.

[tex](m_{A}*v_{A})+(m_{B}*v_{B})=(m_{A}*v_{A'})+(m_{B}*v_{B'})[/tex]

where:

mA = 0.355 [kg]

vA = 0.095 [m/s] before the collision

mB = 0.710 [kg]

vB = 0.045 [m/s] before the collision

vA' = 0.035 [m/s] after the collision

vB' [m/s] after the collison.

The signs in the equation remain positive since before and after the collision, both bodies continue to move in the same direction.

[tex](0.355*0.095)+(0.710*0.045)=(0.355*0.035)+(0.710*v_{B'})\\v_{B'}=0.075[m/s][/tex]

Question 3 of 10
Which law is stated below?
The acceleration of an object is proportional to the force applied to it and
inversely proportional to its mass.
A. The law of inertia
B. Newton's first law
C. Newton's third law
D. Newton's second law

Answers

Answer:

D. Newton's second law

Explanation:

Newton's second law of motion states that force of an object is a product of its mass and its acceleration.

Mathematically, F= ma where  m is mass and a is acceleration

So from the statement above : The acceleration of an object is proportional to the force applied to it and  inversely proportional to its mass , it can be seen from the formula variation as;

F= ma -----making a the subject of the formula

a= F/ m

a= 1/m * F --------- a  is inversely related to m  as you can see from 1/m but directly related to F  hence;

Increase in mass with the same force applied causes the body to accelerate slower where as when force increases, the body accelerates faster.


A sailboat sits tied up at the dock.
Which forces are acting on it?
(A)
applied force and tension force
(B)
electrical force and applied force
(C)
gravity and electrical force
(D)
tension force and gravity

Answers

Answer:B

Explanation:i think so im not suree

A sailboat that is tied up at the dock will experience tension force and gravity. Therefore, option (D) is correct.

What is the tension force?

Tension can be described as a force acting along the flexible length of a medium such as a rope, string, or cable, or a force carried by a flexible medium.

Tension can be defined as an action-reaction pair acting at each end of the elements. For a rope, tension is present in every section of the rope or string in both directions, apart from their endpoints. Each endpoint of the rope will experience tension and force from the weight attached to it.

Tension can also be defined as a pulling force but the tension is not a pushing force. Ropes or strings are used to exert forces since they transfer a force over a specific distance.

Therefore, sailboats experience the tension force due to the rope with which it is tied at the dock and the force due to gravity.

Learn more about tension, here:

brainly.com/question/13676406

#SPJ2

5. Annie drags her little red wagon with a mass of 5.00 kg, up a hill that has an angle of
elevation of 30.09. She applies the force of 150 N parallel to the incline. Assume that
the wagon starts from rest at the bottom of the hill, and neglect friction (4 points)
a) What is the value of the acceleration of the wagon?

Answers

Answer: [tex]25.08\ m/s^2[/tex]

Explanation:

Given

mass of wagon m=5 kg

elevation

[tex]\theta =30.9^{\circ}\\F=150\ N[/tex]

Sin component of weight will oppose the applied force therefore we can write

[tex]F-W\sin \theta=ma\\where\\W=weight(mg)\\a=acceleration[/tex]

[tex]150-5\times 9.8\times \sin (30.09)^{\circ}=5\times a\\125.43=5a\\a=25.08\ m/s^2[/tex]

in physics, the use of force to move an object is called

Answers

Answer:

In physics, work means the use of force to move an object. ... Not all force that is used to move an object does work. For work to be done, the force must be applied in the same direction that the object moves

The use of force to move an object is called Work.

A force can change the motion of an object. A force causes an object with mass to change its velocity (acceleration).

[tex]\bold{Force = Mass\times acceleration}[/tex]

while work is the result of the action when a force causes an object to move in the direction of the force.

[tex]\bold{Work= Force\times Displacement}[/tex]

Therefore, the use of force to move an object is called Work.

To  know more visit:

https://brainly.com/question/4095205

A 1 kg box is sitting on a flat horizontal surface that has a coefficient of static friction value of 0.8. What answer best states the minimum force required to move the box in the horizontal direction?

A. >-9.8N


B. >9.8N


C. >7.84N


D. >9N

Answers

The normal force felt by the box has magnitude

F[normal] = (1 kg) g = 9.8 N

so that the maximum magnitude of static friction is

F[s. friction] = 0.8 F[normal] = 7.84 N

In order to get the box to move, (C) a minimum force of 7.84 N is required.

PLZZZ HELP

In addition to how much force Earth exerts on the object, which features of an object affect its weight?

A.mass and location of the object
B.shape and location of the object
C.location of the object and how much energy the object has
D.mass of the object and how much energy the object has

Answers

Answer/Explanation:

The weight of an object is defined as the force that is exerted due to the gravitational force.

Mathematically, it can be written as :

W = m g

Where

m is the mass of the object

g is the acceleration due to gravity

Also,  

We know that the value of g varies with respect to the location. At the equator, the value of g is less as compared to the poles.

The feature of an object that affects its weight are :

Mass of the object

Location of the object

How much force Earth exerts on the object

What type of matter is likely to absorb the most sound waves

Answers

Answer:

Things like cloth and softmaterial, pliable, or porous materials

Explanation:

Answer:

Porous absorbers e.g paper, cardboards

Water has physical properties that can be
measured and

Answers

Physical properties of water are related to the appearance of water, namely, the color, temperature, turbidity, taste, and odor. ... Turbidity is a measure of the clarity of water. Low-turbidity water is clear, while high turbidity water is cloudy or murky. The unit of measuring turbidity is turbidity

30 Joules of energy enter a light bulb. 20 joules of energy are transformed into light; how much energy is dissipated as heat?

Answers

Answer: 10 Joules will be dissipated as heat.

An object completes 10 cycles in 50s.
a. What is the period of its rotation?
b. What is the frequency of its rotation?

Answers

Answer:

.

Explanation:

Explanation:

Given parameters:

Number of cycles  = 10cycles

Time taken  = 50s

Unknown:

Period of its rotation  = ?

Frequency of its rotation  = ?

Solution:

The period of rotation is the time taken time taken for a body to complete a number of rotation;

 Period  = [tex]\frac{t}{n}[/tex]  

t is the time

n is the number of cycles

 Period  = [tex]\frac{50}{10}[/tex]  = 5s

The period is 5s

Now, frequency is the inverse of period;

   F = [tex]\frac{1}{period}[/tex]  = [tex]\frac{1}{5}[/tex]   = 0.2Hz

The shortstop plays between first and second base.
true or false

Answers

SINGLE TO RIGHT OR CENTER FIELD-On a single to center or right field the first baseman will be the cutoff to home. The shortstop will cover second base.

Which vector below goes from (0,0) to (-2,4)?
A. c
B. a
C. b
D. d​

Answers

Answer:

I believe it is A.c

Explanation:

hope its right

Answer:

the correct answer is A with a line on top

Explanation:

I just did the quiz

Increase or decrease? 35 points ??? Please help

Answers

Answer:    

increase, GPE, KE, KE, KE, PE, PE, KE, KE,

Explanation:

this is the last question

Answers

Answer:

It's C

Explanation:

Which circuit shows three resistors connected in series?​

Answers

The circuit shows three resistors connected in series is the letter B because he elements are connected on the same wire and there is only one path for the electric current to flow.

What is the difference between series and parallel circuit?

The main difference between series and parallel circuit is the way voltage and current are presented. The voltage will be the same at all points in the parallel circuit and the current will vary. In series circuit, it is the voltage that can be different, while the electric current is the same.

In a series electric circuit, the elements are connected on the same wire and there is only one path for the electric current to flow. For this reason, the electric current is the same in all elements of the circuit.

See more about series eletric circuit at brainly.com/question/11853598

After completing an experiment, all chemical wastes should be

Answers

Answer:

The correct answer is

C. disposed of according to your instructor’s directions

Explanation:

The question is not complete here is the complete one with options to choose from

After completing an experiment, all chemical wastes should be

A. taken home

B. dumped in the sink

C. disposed of according to your instructor’s directions

D. left at your lab station for the next class

why does the fire snake weight less than it was when it was on fire

Answers

Answer:

When Zoe weighs the ingredients (sugar and baking soda), it weighs 25 grams in total. When she weighs the “snake” it weighs 23 grams. This is because some carbon dioxide gas produced during the chemical reaction escapes into the air.

Susan makes the following entry in her notebook: “On Friday we were given a blue liquid in a shallow container. We placed it on the windowsill over the weekend. On Monday morning, there was no liquid left, but the dish had some solid blue stuff in it.”

a. Was the blue liquid in the dish a heterogenous mixture, a solution, or a pure substance? Explain your choice.

b. Write a few sentences about what you think happened in the dish.

Answers

Answer:

Explanation:

a. From the information provided in the question, the blue liquid is a solution. This is because a solution is a type of homogeneous mixture (that has an evenly distributed solute in a solvent) which is the reason the liquid was said to be blue (and not immiscible blue solid in a liquid) but after been exposed to heat became just a blue solid. Typically, a solution has a solute and a solvent (combined), the solute here is the blue solid while the solvent is the liquid that made the combination a liquid.

b. Since the dish containing the liquid was placed on a windowsill, it can be assumed that the dish was subjected to heat from the sun which caused the liquid (in the solution) to evaporate after exposure to the heat from the sun (over the weekend) leaving the blue solid solute (of the solution) to remain in the dish. This can be referred to as evaporation to dryness in separation techniques (if the goal was to intentionally separate the solid solute from the liquid solvent).

7. Two people are pushing a 40.0kg table across the floor. Person 1 pushes with a force of 490N
[W], and person 2 pushes with a force of 565N (N). If the coefficient of kinetic friction between
the table and the floor is 0.613, determine the acceleration of the table.(12.7m/s2 [49.1° Nofw])

Answers

Answer:

20.4 [tex]m/s^{2}[/tex]

Explanation:

To start doing this problem, first draw a free body diagram of the table. My teacher always tells us to do this, and I find that it is very helpful. I have attached a free body diagram to this answer- take a look at it.

First, let us see if Net force = MA. To do that, we need to determine whether the object is at equilibrium horizontally. For an object to be at equilibrium, it either needs to be moving at a constant velocity or not moving at all. Also, if an object is at equilibrium, there will not be any acceleration. But we know that there IS acceleration horizontally, so it cannot be in equilibrium. If it is not in equilibrium, we can use the formula ∑F= ma.

Let us determine the net force. Since the object is moving horizontally, we can ignore the weight and normal force, because they are vertical forces. The only horizontal forces we need to worry about are the applied force and force of friction.

Applied force = 1055 N (490 + 565)

Friction force= Unknown

To find the friction force, use the kinetic friction formula, Friction = μkN

μk is the coefficient, which the problem includes- it is 0.613.

N is the normal force, which we have to find.

*To find the normal force, we have to determine if the object is at equilibrium VERTICALLY. Since it has no acceleration vertically (it's not moving up/down), it is at equilibrium. Now, when an object is at equilibrium in one direction, it means that all the forces in that direction are equal. What are our vertical forces? Weight (mg) and Normal force (N). So it means that the Normal force is equal to the Weight.

Weight = mg = (40)(9.8) = 392 N

Normal force = 392 N

Now, plug it back into the formula (μkN): (0.613)(392) = 240.296 N

Friction = 240.296 N

Now that we know the friction, we can find the horizontal net force. Just subtract the friction force, 240.296 from the applied force, 1055 N

Horizontal Net Force: 814.704 N

Now that we know the net force, plug in the numbers for the formula

∑F= ma.

814.704 = (40.0)(a)

*Divide on both sides)

a = 20.3676 m/s^2

Round it to 3 significant figures, to get:

20.4 [tex]m/s^{2}[/tex]

25 POINTS!!!
Copy this concept map, and then use vocabulary terms from the previous page to complete the concept map.

VOCAB
Mechanical wave
Electromagnetic wave
Transverse wave
Longitudinal wave
Frequency
Amplitude
Refraction
Radio wave
Infrared wave
Ultraviolet wave
Transparent
Translucent
Opaque
Intensity
Compression
Rarefaction
Pitch
Decibel

Answers

Muchos mecanismos de un gran encaje solo invierte y eso te ayudará muchísimo

Dexter Eius is running through the cafeteria when he slips on some mashed potatoes and falls to the floor. (Let that be a lesson for Dexter.) Dexter lands in a puddle of milk and skids to a stop with an acceleration of -4.8 m/s/s. Dexter weighs 780 Newtons. Determine the coefficient of friction between Dexter and the milky floor.

Answers

Answer:

 μ = 0.49

Explanation:

For this exercise we can use Newton's second law

Y Axis

       N - W = 0

       N = W = mg

X axis

       -fr = ma

the equation for the friction force is

        fr = μ N

we substitute

       -μ  m g = ma

        μ = -a / g

       

we calculate

      μ = 4.8 / 9.8

      μ = 0.49

why do prescribed drugs need to be prescribed by doctors what can happen if you abuse these drugs without a pressure?

Answers

Answer:

unperscriebed drugs can e harmful to your body

Explanation:

You look at yourself in the mirror and notice many of your physical features: your hair color, eye color, your height, dimples, etc. How does DNA relate to the way you look the way you do?

Answers

well, you get some DNA from both of your parents, so when you hear the phrase, "You have your mother's eyes!" That means you have some of your mother's DNA that gave you her eye color. The DNA you get from your parents help determine how you look today

where should i graph the distance in a distance time graph

Answers

Answer:

Distance in Y axis and Time in axis

Answer:

the distance should be on the Y axis (vertical) and the time should be on the X axis (horizantial)

12. What is the photoelectric effect, and what experimental evidence led scientists
to discover it? Does this support the wave or particle theory of light? Why?

Answers

Answer:

Photoelectric effect, phenomenon in which electrically charged particles are released from or within a material when it absorbs electromagnetic radiation.

Explanation:

The effect is often defined as the ejection of electrons from a metal plate when light falls on it. In a broader definition, the radiant energy may be infrared, visible, or ultraviolet light, X-rays, or gamma rays; the material may be a solid, liquid, or gas; and the released particles may be ions (electrically charged atoms or molecules) as well as electrons. The phenomenon was fundamentally significant in the development of modern physics because of the puzzling questions it raised about the nature of light—particle versus wavelike behaviour—that were finally resolved by Albert Einstein in 1905. The effect remains important for research in areas from materials science to astrophysics, as well as forming the basis for a variety of useful devices.

The emission of electrons from the surface of a metal by the action of light is called photoelectric effect. This phenomenon indicates the behavior of light as particles called photons.

What is photoelectric effect ?

The phenomenon of ejection of electrons from the surface of a metal when light of a suitable frequency falls on it is called photoelectric effect. Upon striking the surface of metals , light can set up an electric current which current which corresponds to the flow of electrons. This phenomenon is discovered by Einstein

For instance, visible light can cause ejection of electrons from the surface of metal like cesium which has low ionization enthalpy. This phenomenon is related to the observation that if light is considered as particles.

The particles of light is then called as photoelectrons or photons. Photoelectric effect find application in photoelectric cells used in colorimetry, spectrophotometers etc.

Find more on photoelectric effect:

https://brainly.com/question/26465043

#SPJ6

Pls Solve this!!!Im giving 20 points and Brainliest to the one who answers first. HELP ME PLEASE!!!!!!!!

Answers

Answer:

i) 2Mg + O₂ + Δ Heat → 2MgO + Δ Energy

ii) The aqueous solution does not change in the color of the blue litmus paper and the blue litmus paper remains blue in color

The aqueous solution formed using the product (MgO) turns the red litmus paper blue

Explanation:

i) Magnesium easily burns in air or oxygen when heated to form a white powder of magnesium oxide. The burning (reaction) of magnesium in air is an exothermic reaction that involves the release of heat and light

The burning of magnesium wire is given by the following chemical reaction;

2Mg + O₂ + Δ Heat → 2MgO + Δ Energy

ii) When magnesium oxide is mixed with water if forms magnesium hydroxide Mg(OH)₂ as shown in the following chemical reaction;

MgO + H₂O → Mg(OH)₂

Magnesium hydroxide is basic and therefore it will turn red litmus paper blue and it does not change the color of the blue litmus paper.

A sound wave traveling through dry air has a frequency of 16 Hz, a
wavelength of 22 m, and a speed of 350 m/s. When the sound wave passes
through a cloud of methane, its wavelength changes to 28 m, while its
frequency remains the same. What is its new speed? (The equation for the
speed of a wave is v= f x.)
A. 350 m/s
B. 9,800 m/s
C. 450 m/s
D. 13 m/s

Answers

Answer:

C. 450

it should be right

The new speed of sound wave is 450 m/s. Hence, option (C) is correct.

What is sound wave?

A sound wave is the pattern of disruption brought on by the movement of energy moving through a medium as it propagates away from the source of the sound (such as air, water, or any other liquid or solid matter).

Pressure waves are produced when an object vibrates, such as a ringing phone, and these waves are known as sound waves.

Frequency of sound wave is = 16 Hz.

Wavelength of the sound wave is = 28 m.

Hence, new speed of sound wave is = 16 × 28 meter/second

= 448 meter/second

=450 meter/second. (approx.)

Learn more about sound wave here:

https://brainly.com/question/21995826

#SPJ5

What type of interference is happening when light waves add together to
become brighter?
Which letter on the diagram shows this phenomenon?

Answers

Answer:

They become brighter in constructive interference because the wave paths donot cancel out, but just strengthen to give a brighter light.

No diagram

Other Questions
A duck walked up to a lemonade stand and he said to the man running the stand: Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? how is a job search conducted One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia Please Help ASAP!!!!!!!!!!!! What is greater -3.2 or -3 A room is 8 meterslong. How manycentimeters is theroom? 2 MATH K.Parker is trying to solve the addition problem below.58 +36 =Drag and drop the numbers below to complete each sentence.Is and PlaceParker will need to change!ones intoten andones. The answer to the addition probleman and1000is 58 +36 =945 - Part 12.: 3:: 5:: 13:: 14:: 15! 84s - Part 2Next2 of 13Copyright 2020 Edmentum, Inc. All Rights ReservedPrivacy Policy California Privacy Rights Contact10:3 List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution Tell whether the triangle is right or not 1. (04.04 HC)Lee y escoge la mejor respuesta. Read and select the best answer.Hoy en da, hay muchos estudiantes que estn perdiendo algo muy importante y profundo en su educacin. Esta es la presencia de la msica y el arte en las escuelas. El estudio del arteayuda a enriquecer a los estudiantes y exponerlos a otras culturas y perspectivas. Estas experiencias ayudan a prepararlos para el futuro. Deberamos gastar ms dinero en el arte y no soloen las ciencias y las matemticas.(1 point)Segn la lectura, que podra ser un gancho para esta lectura? Un gancho para esta lectura podria serO el arte no debera estar en la escuelaO qu es el arte para ti?O cul es el valor de una educacin artstica?O solamente las ciencias y las matemticas How do blood types react in a transfusin ?