Think about what we learned from President Nixon and his speech.

Why is it important to find more than one news source related to a topic that you are interested in or concerned by? What can be the result of only seeking one source?

Please help! tryna finish will give brainlest!​ I have to write two paragraphs so please help I have a lot of assignments to do!

Answers

Answer 1

It is always important to find multiple news sources related to the topic you're writing about so that you have access to more accurate information on your topic, and you will also earn the beneficial experience of hearing the viewpoints of others so that you can develop your own; doing this will also make your writing sound clearer and more precise. The more news sources you use, the more reliable your writing will be.

Answer 2

Answer: Seeking only one source can give a one-sided, biased perspective on a topic.


Related Questions

Answer pweaseee!..........

Answers

Answer:

Museums had enough splinters is correct

Museums had enough splinters is the right choice

this is 6th grade poetry
please help I don't understand​

Answers

Answer:

Option B:

Poets choose words for their meaning and sound.

the answer for this is B

Throughout Act 2 it is implied that Eliza values herself and has self-respect. All of the following provides evidence for that conclusion except...
she has put ostrich feathers in her cap and tried to clean her coat
she stays when Higgins offers her chocolate and taxi rides
she claims that despite not having a mom she is a good girl
she is suspicious of Higgin’s offer and his wager with Pickering

Answers

Answer:

Explanation:

Throughout Act 2 it is implied that Eliza values herself and has self-respect. All of the following provides evidence for that conclusion except...

she has put ostrich feathers in her cap and tried to clean her coat

she stays when Higgins offers her chocolate and taxi rides

she claims that despite not having a mom she is a good girl

she is suspicious of Higgin’s offer and his wager with Pickering

Book: Holes

Stanley and his family half-jokingly blame their misfortunes on Stanley's "no-good-dirty-rotten-pig-stealing-great-great-grandfather." Do you believe in fate — that people are lucky or unlucky — or do you believe, as Mr. Pendanski tells the boys, that we are all responsible for ourselves and our destinies?

Answers

Answer:

Most curses aren't genuine, I believe that we are responsible for our own acts. Weakening our sense of self-judgment by blaming it only on a "cursed relative." As the popular adage goes, "Your life is in your hands; make of it what you want."

Explanation:

 

Answer:

Maybe, it depends.

Explanation:

Sometimes when you watch a movie, or read a story, some part of you feels like there are some people out there who can do things, like put curses on people.

Anyway, most of the time you cause your own problems.

I MET a traveller from an antique land
Who said: Two vast and trunkless legs of stone
Stand in the desert ... Near them, on the sand,
Half sunk, a shattered visage [face] lies, whose frown,
And wrinkled lip, and sneer of cold command,
Tell that its sculptor well those passions read
Which still survive, stamped on these lifeless things,
The hand that mocked them, and the heart that fed;
And on the pedestal these words appear:
"My name is Ozymandias, king of kings:
Look on my works, ye Mighty, and despair!"
Nothing beside remains. Round the decay
Of that colossal wreck, boundless and bare
The lone and level sands stretch far away.

Select one piece of evidence that supports the situational irony of the poem.

Nothing beside remains
I met a traveler
Sneer of cold command
Its sculptor well those passions read

Answers

Answer:

Nothing beside remains

Explanation:

I looked it up and situational irony is irony involving a situation in which actions have an effect that is opposite from what was intended, so that the outcome is contrary to what was expected.

Here, the story basically is that there used to be this king called Ozymandiaz (he was actually Pharaoh Ramses II), who was powerful back in his day, and assumed his descendants would be just as great so he built a statue of his for the generations to come to show his greatness off, saying, “My name is Ozymandias, king of kings: Look on my works, ye Mighty, and despair!"

However, today the statue is destroyed and the top half is blown off, with the head, sneering, is half sunk. The pedestal with the message looks rather awkward and hence the situational irony, because the grand message is in ruins.

Answer:

nothing but remains

Explanation:

i had this question and that dude got it right

Please help me with this ELA question, will give Brainliest. (Isnt this what everyone else says when their wanting an answer really badly?)




Spotify: very simp

Answers

Answer:

A

Explanation:

It just makes sense I don't know another eya to explain

A - It gives an overall idea about the essay, and it makes the most sense

pls help It's just a topic after this we should write the story on paragraph only 3
there is an example

Answers

here’s an idea: girl went into the woods because that’s the quickest way to the farmers market and heard something weird so she went to see what it was and saw a cult. the people in the cult turned around a saw her then she started running away but the people in the cult are demons and chased her and sacrificed her
The characters are on vacation with their family they go to a hotel ( a last minute decision to go to THIS hotel) which at first seems okay however later on they realise that mysterious things are happening they see the maid washing blood of off the sheets they hear noises. The brother decides to read up on the hotel and finds out that the original owner was a serial killer from the 1800’s who was never found. Rumour has it he still haunts the hotel and gets his staff to finish his dirty work

does nine rhyme with chime

Answers

No, it doesn’t. It reminds with chine but not chime.
Not truly but it is a slant rhyme which means the two words don’t exactly match in pronunciation.

Write a short paragraph explaining which selection you preferred reading this week, “Androcles and the Lion” or “Brushfire!,” based on the story plot. You should include references to at least two parts of the drama (beginning, middle, and end).

Answers

Answer:

which is the story plot

Explanation:

What is the plot to your story

can someone complete the story?
i want ideas

Answers

Hello is anyone there? She answered, Yes, who are you? The voice responded, I’m Shenel, are they behind you are you one of them? The girl said, yes they are behind me but I don’t know what they are much less being one of them can I come in please? Shenel said, Yes you can come in but I’m warning you now that I’m armed. The girl opens the door to the image of a girl no older than 16 years old sitting on the floor holding a shotgun pointing towards the door she had just entered through. Shenel looks at the girl as she puts down her shotgun saying, oh my word I’m so glad I’m not alone here anymore. How close are they behind you? We need to leave as soon as we can to avoid them catching us. Shenel quickly stands up and starts packing a bag with things lying around. What’s your name? Shenel says with her back turned packing. Um, I’m Stephine the girl answers shakily. Ok that’s a nice name Stephine sorry for all of this happening but we really need to leave now. Shenel stops packing and turns to look at Stephine. Are you ready? Stephine looks at Shenel and says, Who are those people, and where is everyone else, what’s happening I need some answers please! Shenel stops and sighs, ok so I’ll try to give you the short version ok. Stephine nods yes at Shenel. Shenel takes and deep breath and says, ok so those people are all a part of a cult and truthfully they aren’t really people they are demons and they have sacrificed every person they have been able to catch, so we need to go ok I can keep us safe there is a bunker we need to make it to it’s about 15 miles from here ok so let’s head out now I think I hear them coming now! Stephine and Shenel head out of the house listening closely as they can for any signs of someone behind or in front of them but all Stephine is able to hear is her heart racing in her chest as they run. Shenel stops suddenly and looks back at Stephine with fear in her eyes and whispers shakily, look don’t stop running I’m going to try warding them off we are only about a mile and a half from the bunker. Stephine just then realizes they are starting to be surrounded by at least 150 demon people. She looks back and says, what about you? Shenel says , save yourself I will be ok, on three ok, 1, 2, Shenel screams 3! Stephine bolts not looking back hearing the sound of gunshots and screaming it only makes her run faster and her heart feels like it’s going to beat right out of her chest. Just as she thinks she is never going to make it she sees a big door with a yellow sign on the front reading, emergency bunker. She runs up yelling for someone to open the door. She hears something running behind her and she becomes frantic. LET ME IN, LET ME IN!! Right as she thinks there is no hope the door opens and she runs in as she looks back she sees Shenel and yells, RUN YOU CAN MAKE IT!! Right at the door is almost closed Shenel makes it in the door they both embrace each other in a hug crying they say, We made it, We are ok! The end
There is a really big story above so read that if

Directions: Read each question carefully. Write the letter of the correct answer on the blank before the number.
_____1. What are those words that are used to describe a verb, or an adjective?
A. noun b.verb c. adverb d. pronoun
_ _2. What kind of adverb tells how the action is done?
a. adverb of time b. adverb of place c. adverb of manner d. adverb of degree
_____3. Which of the following is not an adverb of manner?
a.lovely b.seriously c. happily d. easily
_____4. In the sentence, “The horse runs fast.” Which is the adverb of manner?
a. horse b. runs c. fast d. none of these
_____5. What word will best complete the sentence, “The baby cried ________ (loud) at
night.”?
a. loud b. loudly c. loudness d. loudliness

Answers

1. adverb. 2. adverb of degree. 3. lovely. 4. runs. 5. loudly.

hope this helps!
First one is the adverb
Second one is d
Third on is b
Fourth is fast
Fifth is b

Who are two target audiences for the passage "Gluten Free"? IMAGE DOWN BELOW.

Answers

The answers are D and E
the correct answers are d and e

Need help, I've already failed this twice.

Answers

The correct answer to this question would be D.

Answer:

C sounds the best

Explanation:

Is this the right punctuation or do I take one of the “you” out?

Answers

Answer:

I think it is correct

Explanation:

I thinks it is correct with the way you have it, also with,"Thanks, you are too," but you have it fine the way it is.

“thank you, so are you.”

List the three reasons why the Bible is one complete book. Use complete sentences.
ANSWER QUICK AND ILL GIVE BRAINLY

Answers

The bible is a complete book because it has a beginning and an end. A bible also has chapters like all books do as well as characters.

The three reasons are Firstly it contains a cohesive storyline and message that is consistent throughout its 66 books. Secondly, the Bible has been recognized and accepted as a single book by the majority of Christian denominations and believers worldwide. Thirdly, the Bible has had a profound impact on world history and culture, shaping the beliefs, values, and practices of countless individuals and societies.

What is the Holy Bible?

The Holy Bible is a collection of sacred scriptures that are considered by Christians to be the inspired and authoritative Word of God. It is comprised of 66 books, written over a period of more than 1,500 years by more than 40 different authors.

The Holy Bible is divided into two main sections: the Old Testament, which contains the books written before the birth of Jesus Christ, and the New Testament, which contains the books written after his birth.

The Holy Bible is regarded as a source of spiritual guidance and moral instruction, and its teachings have been a cornerstone of Christianity for centuries. It covers a wide range of topics, including the creation of the world, the history of the Jewish people, the life and teachings of Jesus Christ, and the future of humanity. The Bible has been translated into numerous languages and is widely read and studied by Christians around the world.

Here in the question,

The Holy Bible is considered one complete book for several reasons.

Firstly, it contains a cohesive storyline and message that is consistent throughout its 66 books, written over a period of more than 1,500 years by more than 40 authors. Despite the diversity of its authors and the span of time over which it was written, the Bible presents a unified narrative of God's relationship with humanity, from creation to redemption.

Secondly, the Holy Bible has been recognized and accepted as a single book by the majority of Christian denominations and believers worldwide. The canon of the Bible was established through a process of discernment and agreement among early Christian communities, and the resulting collection of texts has been revered and studied as one unified body of scripture for centuries.

Thirdly, the Holy Bible has had a profound impact on world history and culture, shaping the beliefs, values, and practices of countless individuals and societies. Its influence extends beyond religious circles to literature, art, music, and other fields of human endeavor, making it a singular and enduring work of profound significance.

Therefore, the above three best reasons that show the Holy Bible is a complete book.

To learn more about the excerpt click:

brainly.com/question/4101236

#SPJ3

Can somebody please help me with this assignment you can pick any random name and last name and you have come up with a fake address pls help ASAP​

Answers

Answer: I can help you. So my name is Avianna, you spell it like A-V-I-A-N-N-A. I spell my last name like Penn. My address is 5901 Blondo Street. My phone number is 402-671-3997

Explanation:

No need for an explanation. If another student needs help we help them.

The fake last name could be brown or smth

7455 Camarilla Ave,
Yucca Valley, CA
92284 (it’s a house for sale)

Any helpful tips on how to do cursive?

Answers

Don’t focus too much on how you’re writing. Simply let your hand lightly flow across the page and start by writing you own name!

Answer:

1. Get Back to the Basics. The first thing you can do to improve your cursive writing is to simply brush up on the basic cursive alphabet.

2. Make the Switch. If you’re trying to improve your cursive writing while maintaining print as your main writing method, then it’s time to make the switch fully.

3. Keep it Simple. Lots of people, myself included, have decided to pick up cursive again thanks to hand lettering. ...

Explanation:

Think and search

Which detail is included in Dragonwings by Laurence Yep, but not in the film?

A) a driving cap
B) a trolley
C) bicycles
D) horseless carriages

The answer is D) horseless carriages

Answers

Answer:

thank you so much!!

How are you by the way?

The answer is D) horseless carriage

help me please (NO LINKS)
Whoever writes this for me i will give u brainlest

Answers

Answer:

Dear Principal,

Recently I made a purchase of P.E equipment from the campus. Upon reviewing the gear, I noticed the gear was faulty and unusable. The size was incorrect from what I ordered and there was a hole on the top end of the equipment.

This is just to get you started, I don't have much time to finish. Good luck.

Answer:

Dear Principle, My parents have bought P.E from the school office. Unfortunetlly, it is not the correct size that we requested, there is lots of damage to the equipment also, making the gear unusable and futile.

Explanation:

I hope this helps :)

Directions: write two of your own inverted sentences.
1) ____________________________________________________________________

2) __________________________________________________________________

Answers

Answer:

1. Sha said, "I finally completed reading the Harry Potter series yesterday."

2. He said, "I met in an accident and broke my leg last week"

How were you able to give brainliest when only one person answered?!

Imagine a different ending for the scene: Ed says, “You’re right, Meg! It’s only a piano!” He rushes out of the house with the family and they all drive away to safety.
Remember that what you have read from “Brushfire!” is only a part of the drama

Answers

Answer:

Ed says "This piano sure is weird" (Looking at piano suspiciously)

(Mag turns to Ed) "I told you, it's only a piano. We need to go!"

Ed: Come on!

Mag: Hurry up or we will get caught in the fire!

Ed: Come on! I am curious to what it is hiding. (Looking at mag with puppy dog eyes)

Mag grabs Ed and feels the door as she turns to ed worried

Mag: The door is hot!

The door burns down, as firefighters are standing inside, they go in to rescue them. They are safe, but they are a bit hot.

Surprisingly the 2 kids survived this flaming fire,the kids did not know what to do after, they were confused on how this happened, but they were thankful about one thing

How do the authors of the two articles address the same topic in these excerpts?

A Article A highlights the quality of the sea otter's fur while Article B focuses on conservation efforts that have saved the sea otter in recent years.
B Article A focuses on the characteristics of the sea otter's fur while Article B focuses on sea otter fur being one of the reasons the animal was hunted.
C Article A includes historical facts about the significance of the sea otter's fur while Article B focuses on the different ways that the population has recovered.
D Article A focuses on the sea otter's vanity over its fur while Article B focuses on human vanity to hunt and use sea otter fur for coats and clothing.

Answers

How does the author of the two articles address the same topic in these excerpts?
Answer-B
The answer is nunber B

Write a three-sentence summary of “Gold Rush!” using at least one word from the spelling list in each sentence.

Answers

Answer:

Forty-niners rushed to California with visions of gilded promise, but they discovered a harsh reality. Life in the gold fields exposed the miner to loneliness and homesickness, isolation and physical danger, bad food and illness, and even death. More than anything, mining was hard work.

hope helped you anyway possible good luck

Explanation:

Answer:

Greedy. Fleshy. Humans.

Explanation:

Sorry, major brain fart right there.

ASAP WILL MARK BRAINLIEST! NO LINKS PLEASE ,DUE IN 5 MIN!

Answers

Answer:

I don't understand what your asking.

Explanation:

Verbs: Photoing, photed
Nouns: Photograph, photographer
Adjectives: Photosensitive, photofinishing
Adverbs: photogenically

Verbs: (I have no idea)
Nouns: Philosopher, Philanthropist
Adjectives: Philanthropic
Adverbs: Philately

I hope this helps! I wasn’t quite certain of what you needed.

Hi savaine this is for you

Answers

Hi how are you........

Answer:

Hello.

Explanation:

Sorry, I know I'm not this "savaine" person but my OCD wanted to make my answers into 20 instead of 19.

Submit your nota bene paragraph (5-7 sentences) about a current event in your life. Use as many of your spelling words as you can, and check that you spell them correctly and underline them.

Word bank: benefactor, benevolent, benediction, beneficiary, benefactress, beneficial, benefit, beneficence, glacier, environment

Answers

Answer:

I DONT KNOW SORRY

Explanation:

Select the correct answer.
Review the following writing prompt. Then answer the question that follows.
Prompt: Doctors are learning more about the serious head injuries suffered by people who play certain sports. What changes should the sports program in your school make to protect students from head injuries?
Based on the writing prompt, which research question would best help you narrow your topic for a five-paragraph essay (300 words)?
A.
When did doctors first discover that head injuries occurred in contact sports?
B.
Is it easier to recover from a back injury than it is to recover from a head injury?
C.
What extra steps can coaches take during games and practices to keep students safe?
D.
How can schools encourage more students to participate in school sports?
E.
Why doesn’t the human skull provide enough protection to avoid head injuries from sports ---------------------------------------------------------------------------------------------------------------------

Answers

It’s b bro I done my work

Answer:

I think it's B.

hope this helps!!

The answer choices are spelling rules about what to do before adding suffixes to a base word that ends in e. Identify the rule that would be applied to the word below.

accommodate + -ions

Keep the final e only if it lets g or c make their soft sounds.
If the suffix starts with a consonant, keep the e and add the suffix.
If the suffix starts with a vowel, drop the e and add the suffix.
This word is an exception to the rule.
If a base word ends in double e, do not drop the final e, but never write three e's in a row.

Answers

Answer:

Drop the 'e' before adding a suffix. C.

Explanation:

Drop the e before adding the suffix C

Refer to your Expeditions in Reading book for a complete version of this text.

Which two responses are main ideas from “Young Frederick Douglass”?

Main Idea 1 And Main Idea 2 (choose)

To travel, Douglass uses a friend's identification papers and dresses as a sailor.

Douglass earns respect and becomes well known for his intelligence and his gift for writing.

Once he achieves freedom, Douglass continues to work for equal rights for black people.

Douglass lives in England for two years and works as a public speaker.

Answers

The two responses that are the main ideas from “Young Frederick Douglass

Once he achieves freedom, Douglass continues to work for equal rights for black people.To travel, Douglass uses a friend's identification papers and dresses as a sailor.

Who is Young Frederick Douglass?

Young Frederick Douglass was an African-American social reformer, abolitionist, and orator.

He was also known for helping to fight for equal rights for black people.

Learn more about Young Frederick Douglass at:

https://brainly.com/question/21071126

Use the words below to fill in the blanks.
Fawned
Launched
Installment
Jaws
Stalk
Awesome
Because
Always

Answers

1.always
2. Awesome
3.because
4.fawned
5 installment
6jaws
7 launches
8 stalk
1. Always
2. Awesome
3. Because
4. Fawned
5. Installment
6. Jaws
7. Launched
8. Stalk

I am a middle schooler and might not be right. Thank you!
Other Questions
When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? g If the beginning work in process includes 200 units that are 20% complete with respect to conversion and 30% complete with respect to materials. Ending work in process includes 100 units that are 40% complete with respect to conversion and 50% complete with respect to materials. If 1,000 units were started during the period, what are the equivalent units of productions for the period (using the weighted-average method) for conversion What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate