TRUE / FALSE
"Automania" caused the need for roads linking major cities and suburban living.

Answers

Answer 1

Answer:

true (i think so)

Explanation:

Auto-mania spurred local and state government to construct roads linking the major cities while connecting schools

I hope this helps a bit.


Related Questions

In what two ways were the Ottoman, Safavid, and Mughal Empires similar?
They isolated themselves from outsiders and were intolerant towards the people they
conquered.
They all contained majority Muslim populations and participated in the Trans-Saharan
trade.
They used guns and artillery to conquer large empires and were led by Muslim rulers.
They were led by Sultans and spread Hellenistic art and architect throughout Asia.

Answers

They all contained majority Muslim populations and participated in the Trans-Saharan trade are the two ways were the Ottoman, Safavid, and Mughal Empires similar. Hence, option B is correct.

What was the major effect of the trans-Saharan trade?

Northern and Western Africa's economies expanded as a result of trans-Saharan commerce. West African trade was governed by vast Islamic trading empires. These commercial edifices adopted Islam and helped the spread of Islamic culture in the area.

Trans-Saharan trade connected the sub-Saharan economies, where gold was abundant, to the Mediterranean economy, which wanted gold but could offer salt, from the seventh to the eleventh centuries.

Along with the growth in trans-Saharan trade came the expansion of the Ghana Empire, which was located in what are now Mali, Senegal, and southern Mauritania. West African nations like Wangara had abundance of gold but needed salt, but northern economies occasionally held salt mines like Taghaza in the Sahara.

Thus, option B is correct.

For more information about major effect of the trans-Saharan trade, click here:

https://brainly.com/question/18713948

#SPJ5

Unit 5, AP World History. Explain the extent to which the Enlightenment affected societies over time.

Answers

Answer:

Short Answer

Explanation:

The Enlightenment led to many changes in societies. One major change could be the spreading of the idea of the separation of church and state. A foreign idea up to this point. It also introduced the ideas of constitutional government. Tolerance of those different to you (Race, Religion, etc.) rose in reaction to this.

The Enlightenment brought about a lot of social transformation. The idea of separating church and state could undergo a significant transformation.

What is social?

Referring to extracurricular activities that take place when you're not working and where you interact with others: When I was in college, I was very social. pertaining to human society, individual-group interaction, or the well-being of people as members of society

The unknown concept up to this point. The concepts of constitutional government were also introduced. This led to a rise in tolerance for individuals who are different from you (in terms of race, religion, etc.).

Therefore,  social transformation. The idea of separating church and state could undergo a significant

Learn more about social here:

https://brainly.com/question/28218484

#SPJ2

After the Han Dynasty fell, China was divided by civil war.
True
False

Answers

Answer:

True

Explanation:

no one was powerful enough to reunify China under a single emperor. The result was the period of the Three Kingdoms

empires! i need help! answer my question

Answers

Answer:

the third one hope this help.

Explanation:

Use this week's issue of Studies Weekly to help you answer this question. Include the page number and article that helped you find the answer in your response. Explain how some Hindus were polytheistic, while others were monotheistic.

Answers

The correct answer to this open question is the following.

Although you do not mention what was your week's issue of Studies Weekly to help you answer this question, we can indeed comment on the reason why some Hindus were polytheistic, while others were monotheistic.

Here we go.

Historians and scholars say that in Hinduism, there is a monotheistic conception of divinity but also a polytheistic pantheon of gods for the following reasons.

There is what we can understand as a monotheistic conception of one god in Hinduism. This concept teaches that there is one great mighty god, Hindus call it Brahman. He is the divine force that created everything. So Hindus believe in this original creative force that gave life to everything.

On the other hand, there is a polytheistic approach to Hinduism in that believes that different deities stem from that great Brahman god. We are talking about deities such as Shiva, Ishvara, Hanuman, Ganesha, Vishnu, Vedi, Krishna, Rama, Durga, and Kali, among many others. Hindu pantheon is extensive.

These many gods represented one aspect of creation and Earth, such as the deity of creation and destruction, a deity for knowledge, a deity of dark, a deity of prosperity, and more.

What was the main goal of the Farmers’ Alliance?

Answers

Answer:Allow farmers the opportunity to join together for the purpose of purchasing equipment and exhibiting political strength

Explanation:

hope this helps and pls mark brainliest :)

How did Indus River Valley civilizations respond to flooding in their area?
O Flooding provided enough water supply to help cities grow.
O Farmers developed irrigation techniques in response to flooding.
O Traders could travel easily due to the flooding from the monsoons.
Cities were easy targets for invasion due to flooding in river systems.

Answers

Answer:

Explanation:

Farmers developed irrigation techniques in response to flooding

Answer:

Farmers developed irrigation techniques in response to flooding.

Explanation:

The flooding of the Indus River as a result of monsoons and melted snow caused the Himalayas to overflow.  At Mohenjo-Daro, there was a network of canals which diverted the flood water of the Indus River for irrigation.

Joe will have to pay a tax of 6% on his new television. The television costs $199. Estimate the sales tax.

Answers

Answer:

6 dollars per hundred... 2 hundred.... $12

to be exact- $11.94

Amount of sales tax = $11.94 dollars;

Price with sales tax = $210.94 dollars;

Explaining-

Amount of sales tax =

Sales tax rate × Price without sales tax =

6% × 199 =

6/100 × 199 =

0.06 × 199 =

11.94;

Price with sales tax =

Price without sales tax + Amount of sales tax =

199 + 11.94 =

210.94;

__________

Hope this helps

-Lexi

what style of art emphasizes emotion. feeling. and imagination?
a] realism
b] impressionism
c] cubism
d] romanticism ​

Answers

Answer: d] romanticism

Explanation: This is because a lot of art in this period has loose brushwork and strong color contrasts.

Answer:

b

Explanation:

Why did President John Adams lose the support of many Federalists?

Answers

Answer:

The Federalist Party split because even though John Adams was a Federalist he resisted Alexander Hamilton's pressure for war. This disagreement created the Federalist Party to split.

Explanation:

What did Native American groups do to fight more effectively in the Northwest?

Answers

Answer: The Native American groups became allies with Britain and Spain.

FROM THE MOVIE POMPEII:THE LAST DAY

On his way to Pompeii, Pliny the Elder passed by this city that needed his help:
a. Herculaneum
b. Rome
c. Naples
d. Crete

Answers

the answer is a .

A. herculaneum

Why do you think Albert Einstein regretted his decision to help construct the bomb?

Answers

Answer:

Einstein was not involved in the bomb's creation. He was not allowed to work on the Manhattan Project — he was deemed too big a security risk, as he was both German and had been known as a left-leaning political activist.

Explanation:

What could be some ways for the country to improve the economy? Explain

Answers

1. Lower interest rates – reduce the cost of borrowing and increase consumer spending and investment.

2. Increased real wages – if nominal wages grow above inflation then consumers have more disposable to spend.

3.Higher global growth – leading to increased export spending.

Answer:

Sigh.

Explanation:

There's a lot of ways. I don't in any way mean for this answer to sound political, but if it does, I apologize.

Ways to Improve the Economy:

1. Restore trees. More reforestation! (An annual federal investment of $4-4.5 billion in tree restoration could help these communities recover by bringing in $6-12 billion per year in economic growth. That investment could also fight climate change cost-effectively, removing nearly 10% of annual U.S. emissions at less than $10 per ton of carbon dioxide.)

2. Invest in a low-carbon economy (creates jobs and reduces emissions)

3. Not raise taxes (sounds like making people poor)

4. Not raise gas prices (if people can't afford gas, then they can't get to work)

5. Invest in small businesses (Small businesses give back to the community by creating new jobs and offering consumers the ability to contribute to the cause of supporting the local economy.)

6. Become an entrepreneur (New and improved products, services, or technology from entrepreneurs enable new markets to be developed and new wealth to be created. Additionally, increased employment and higher earnings contribute to better national income in the form of higher tax revenue and higher government spending.)

7. Increase spending on infrastructure (more jobs, more facilities, better roadways is equivalent to big trucks hauling stuff worth a vast sum and granting the US more money faster)

8. As economies grow, energy demand increases; if energy is constrained, GDP growth pulls back in turn. Therefore, increase energy affordability and sources.

9. Reduce pollution (more higher-paying jobs, cleaner environment)

That's about all I can think of. I hope this helps. I also used a couple descriptions from the Internet.

HELP ME PLZZ, ASAP!!

What is opportunity cost?

Answers

Answer:

Opportunity costs represent the potential benefits an individual, investor, or business misses out on when choosing one alternative over another. The idea of opportunity costs is a major concept in economics.

Answer:

Look below

Explanation:

Opportunity cost is when you lost an opportunity/chance to benefit from something because you took the wrong alternative/choice resulting in a loss of benefit.

what does ceasar say to indicate he is suspicious of cassius?List at least two reasons​

Answers

Answer: Caesar does not like Cassius because he is too lean, thinks too much, reads too much, does not like plays, and never smiles sincerely. Caesar may not have known that there was a conspiracy to kill him, but he did not like Cassius. He explained to Antony why he was suspicious of him.

Explanation:

what did the united states do to encourage texas to give up some of its’s land

Answers

Answer:

The United States offered to pay off its debt to encourage Texas to give up some of its land.

Explanation:

*PLEASE ANSWER, ITS CONFUSING*

What was the significance of the battle at Fort Wagner?

a.) The special skills applied by an all-female unit challenged the assumption that women could not be useful agents of war.

b.) The mettle showed by African-American troops demonstrated that race was not a significant factor in a soldier's capability or courage.

c.) African-American soldiers led the charge, eager to fight, but were stopped and turned by back by white soldiers.

Answers

Answer:

Pretty sure its b

Explanation:

Battle of Fort Wagner paved the way for more African Americans to enlist.

PLS HELP 100 POINTS!!
Your final product is an essay that synthesizes primary sources and answers the question: How did immigration affect immigrants and other Americans around the year 1900?

Answers

Answer:

Between 1900 and 1915, more than 15 million immigrants arrived in the United States. That was about equal to the number of immigrants who had arrived in the previous 40 years combined. In 1910, three-fourths of New York City's population were either immigrants or first generation Americans (i.e. the sons and daughters of immigrants).

Not only were the numbers of immigrants swelling, the countries from which they came had changed dramatically as well. Unlike earlier immigrants, the majority of the newcomers after 1900 came from non-English speaking European countries. The principal source of immigrants was now southern and eastern Europe, especially Italy, Poland, and Russia, countries quite different in culture and language from the United States, and many immigrants had difficulty adjusting to life here.

At the same time, the United States had difficulty absorbing the immigrants. Most of the immigrants chose to settle in American cities, where jobs were located. As a result, the cities became ever more crowded. In addition, city services often failed to keep up with the flow of newcomers. Most of the immigrants did find jobs, although they often worked in jobs that most native-born Americans would not take. Over time, however, many immigrants succeeded in improving their condition.

What skills did Dorthea Dix
have that also led to her
accomplishments

Answers

she played an instrumental role in the expansion of more than 35 hospitals

His travels in Gia, India led him to use plants for medicine, including what, used to treat malaria.

Answers

The correct answer to this open question is the following.

Although there are no options attached we can answer the following.

His travels in Goa, India, led him to use plants for medicine, including what, used to treat malaria.

Here, we are talking about Portuguese herbalist and physician García de Orta.

García de Orta (1501-1568) did deep research for that time to discover how to treat malaria and other diseases. He was one of the first physicians to develop research on tropical medicine and used ethnobotany to help people in Goa, India.

He had to do much experimentation with plants of the region, He thought that would better than traditional medicine that had already shown its limitation to treat tropical diseases.

He also had the time to write a book titled "Magnus Opus," in 1953, in which he referred to the use of herbal medicine and its benefits.

why do you think that Gran Colombia failed?

Answers

Answer:

gran colombia was dissolved in 1831 due to the political differences that existed between supporters at federalism and contralism as well as religional tensions among the peoples that made up the republic

What is the definition of Aryan?

Answers

Answer:

relating to or denoting a people speaking an Indo-European language who invaded northern India in the 2nd millennium BC, displacing the Dravidian and other aboriginal peoples.

Explanation:

What does "stout matron" mean?

Answers

Answer: Matron: a married woman, especially one who is mature and staid or dignified and has an established social position.

Explanation: hope this helped you :)

Answer:married woman

a married woman, especially one who is mature and staid or dignified and has an established social position.

Explanation: sorry if im wrong :(

the great compromise established that:

Answers

Answer:

D

Explanation:

All the states even the smaller ones got the same amount of representatives as the larger states.

Answer:

the answer is c

Explanation:

error-free and the other is a trip that is going on in my mom and family in a couple weeks so we can talk more if we need help me

And this one I need help

Answers

Answer:

its d the south free all slaves but im not 100% sure

Explanation:

What was the purpose of the caste system?

Answers

Answer:

The caste system in ancient India was used to establish separate classes of inhabitants based upon their social positions and employment functions in the community.

Explanation:

Hope this helps:)

What is the role of family in the philosophy?

Answers

The role of family in the philosophy is families looks at the beliefs ,value ,and ideals of children.

Why did the United States become involved in the Vietnam War?

Answers

Answer:

here

Explanation:

China had become communist in 1949 and communists were in control of North Vietnam. The USA was afraid that communism would spread to South Vietnam and then the rest of Asia. It decided to send money, supplies and military advisers to help the South Vietnamese Government.

1. Presenta un resumen explicando los cambios experimentados por el hombre durante la Prehistoria. Recuerda indicar como cada uno de ellos impactó la manera en que vivían.

Answers

La respuesta correcta para esta pregunta abierta es la siguiente.

A pesar de que no se anexan opciones o incisos para responder la pregunta, podemos comentar lo siguiente.

Los cambios experimentados por el hombre durante la Prehistoria fueron los siguientes.

Los primero humanos que aparecieron sobre el planeta enfrentaron una gran cantidad de problemas. Para poder sobrevivir exitosamente a las adversidades, tuvieron que desarrollar una serie de habilidades para adaptarse al peligroso medio ambiente que los rodeaban.

El humano era una creatura muy pequeña e indefensa ante el asecho de los animales salvajes que habitaban la Tierra.

Los humanos tuvieron que seguir la migración de las mandas de animales para poderlos cazar y alimentar a sus familias. Por eso se les llamó nómadas, porque no se quedaban en un sitio, sino que tenían que seguir a estos animales. Durante su caminar, recogían frutas y vegetales con los que también se alimentaban.

Los humanos buscaban cuevas y lugares más seguros que la intemperie para poder dormir u resguardarse de los elementos y el clima.

El tiempo transcurrió y la evolución, junto con la necesidad, hicieron que los humanos supieran usar las piedras para construir herramientas y armas más sofisticadas para poder cazar, defenderse y construir. Pudieron tallar la roca para construir armas como flechas y lanzas filosas.

La piel de algunos animales sirvió para cubrirse y resistir las temporadas frías.

Descubrieron el fuego años después, lo cual les dio una gran ventaja no solo para calentarse, sino para cocinar los alimentos y defenderse.

Posteriormente, los humanos aprendieron algunas técnicas de agricultura, y ahí es cuando decidieron asentarse un un sólo sito o construyeron sus primeras casas con rocas y ramas de los árboles. Eligieron lugares cercanos a los ríos para usar el agua para vivir y regar sus cultivos.

Tal fue el caso de la civilización más antigua sobre la tierra: los Sumerios, que se asentaron en medio de los Ríos Tigris y Éufrates, en la región del Medio Oriente.

Other Questions
PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 Can someone help me with this? And no links or random answers please. i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Juan wants to buy a doll house that is 45% off. The original price is$74.85.What is amount of discount (nearest hundredth)?Answer this quick pls!! :,) Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee Create a complete sentence from each of the following phrase fragments. Add capitalization and punctuation wherever necessary.EllenExample1. has been a gymnast.managing the store International trade theory attempts to explain why nations trade and to help predict the direction, composition, and volume of goods that will be traded A variety of different theories have been proposed over the past several centuries to help explain the existence of trade between nations and to help predict whether trade will occur, what products or services will be traded, the direction of this trade, and the volume of this trade. Understanding the differences between these theories helps managers and policy makers to understand whether and how to pursue trade opportunities internationally Drag each of the general characteristics listed to the international trade theory that it is most associated with:International Trade Theory General Characteristics Government stimulates trade by means of protectionism Mercantilism Factors that can drive competitive advantage for one economy over another Absolute Advantage Trade influenced by relative income levels Comparative Advantage Trade materials that are abundant Trade most efficiently produced goods Differences in Resource Endowments Overlapping Demand Trade goods and services at a lower opportunity cost than others Diamond Model of National Competitive Advantage imeter, Area, Dimensions - Real World Hacice estions Notes/Examples 1. A triangular garden has sides measuring 14 feet, 17 feet, and 28 feet. If Cody is laying a brick ETER border around the garden, how many feet of brick will he laya uchs Hihe rectangular path Why did the cost of spices decreased so much? Who's the first person to reach the moon how a positive personal lifestyle plan may promote meaningfulness of life Soro bought a $50.00 bus card at the beginning of the week. Each bus ride costs $2.50. He needs to have at least $20.00 on his card at the end of this month.To determine how many bus rides he can take between now and the end of this month, Soro wrote and solved the following inequality:50 minus 2.5 x greater-than-or-equal-to 20. Negative 2.5 x greater-than-or-equal-to negative 30. x greater-than-or-equal-to 12.What error, if any, did Soro make when writing or solving this inequality Which of the following would be a good hook for a personal essay? Jim began a 222-mile bicycle trip to build up stamina for a triathlete competition. Unfortunately, his bicycle chain broke, so he finished the trip walking. The whole trip took 8 hours. If Jim walks at a rate of 5 miles per hour and rides at 33 miles per hour, find the amount of time he spent on the bicycle.