Answer:
Explanation:no para3 here
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?
Answer:
3.5264 x [tex]10^{7}[/tex]
Explanation:
The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.
In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.
So the short ton produced will be
= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102
= 3.5264 x [tex]10^{7}[/tex] short ton.
Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.
please HELP me i cant fail this class What are the two forces of gravity that contribute to tectonic plate movement at mid-ocean ridges?
Ridge subduction and slab flight
Ridge slip and slab slide
Ridge push and slab pull
Gravity does not pull them
Answer:
"Plate movement is thought to be driven by a combination of the motion of the seafloor away from the spreading ridge (due to variations in topography and density of the crust, which result in differences in gravitational forces) and drag, with downward suction, at the subduction zones."
Explanation:
Does this help?
It is because of ridge slip and slab slide i the divergent plate boundaries, where tectonic plates movement creates mid ocean ridges.
What is divergent boundary?Divergent plate boundaries are the regions where the tectonic plates are diverging from one another, this is known as a divergent plate boundary. Above upward convection currents, this happens.
The lithosphere's base is pushed upward by the rising current, which lifts it off the ground and flows lateral currents beneath it. When an oceanic lithosphere border diverges, the rising convection current beneath raises the lithosphere, creating a mid-ocean ridge.
The plate material above is dragged along in the flow direction by this lateral flow. The overlaying plate is thinned out, fractures, and pulls apart at the peak of the uplift.
Hence, in fact it is not by the gravitational pull but by the ridge slip.
To find more on plate movement, refer here:
https://brainly.com/question/3970445
#SPJ6
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
A frog that is dominant for its light green color mates with a brown frog and produces one small brown frog. How is this possible if the green color is dominate?
Answer:
The dominant (light green) parent was heterozygote for the trait
Explanation:
According to Gregor Mendel in his law of dominance, an allele is said to be DOMINANT if it masks the phenotypic expression of another allele in a gene. The allele being masked is called RECESSIVE allele. In this case of a frog whose allele for light green color is dominant over the allele for brown color, the light green color allele (G) is dominant while the brown color allele (g) is recessive.
However, in a cross between that have light green frog and a brown frog, a small brown frog is produced. This is possible despite the green color being dominant because the genotype of the light green dominant parent is HETEROZYGOUS i.e. it contains both light green (dominant) allele and brown (recessive) allele.
Hence, when a gamete with recessive allele (g) is produced by the heterozygous light green frog (Gg), it mates with a recessive allele from the brown frog (gg) to produce a brown offspring (gg).
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
How does the force of gravity move objects in the solar system?
Answer:
One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun
Explanation:
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
what RNA nitrogen bases match with the following DNA nitrogen bases?
Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem
Which plant propagation process insures some genetic diversity?
Answer:
Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.
Explanation:
Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.
Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
Which is required for sexual reproduction
Answer:
meiosis
Explanation:
meiosis is used to produce gametes for sexual reproduction
Answer:
Meiosis, and female and male
Explanation:
Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.
How many factors should a well-designed experiment test at one time?
Answer:
Depends on the number of experiment variables.
Explanation:
You should only test one variable/factor
A student placed a small chip of limestone into a hydrochloric acid solution, and carbon dioxide gas was released. The carbon dioxide provided evidence that
A. The formation of an element occurred.
B. Only a physical change occurred.
C. A chemical change occurred.
D. Only a loss of mass occurred.
C. A chemical change occurred.
Eukaryotic cells can be specialized for specific tasks in multicellular organisms
true
false
what is a sedimentary rock
Answer:
Sedimentary rocks are formed from pre-existing rocks or pieces of once-living organisms. They form from deposits that accumulate on the Earth's surface. Sedimentary rocks often have distinctive layering or bedding. Sedimentary rocks are types of rock that are formed by the accumulation or deposition of mineral or organic particles at the Earth's surface, followed by cementation. Sedimentation is the collective name for processes that cause these particles to settle in place. Sedimentary rocks are made when sand, mud and pebbles get laid down in layers. Over time, these layers are squashed under more and more layers. Eventually, the layers are lithified – turned to rock. Sedimentary rocks can be formed in deserts, lakes, rivers and seas .
I need help with this (last question I had had the picture all black)
Answer:
I only know A
I think it's the lap
Is sand called sand because its in between the sea and the land?
I'm asking the questions that need to be asked people! :'D
No, not at all. ... The English word 'sand' comes from Old Dutch/proto-German 'zand', which has nothing to do with either sea OR land, but referred originally to unstable ground, as near rivers.
I hate the English language sometimes, like: "waterfall". But anyways, I hope this helps ^^
Hmmm... I've never thought of that before... nice catch lol
Have a great day :D
Inherited used in a sentence
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes
The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.
What do you mean by Genotypes?Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.
In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.
Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).
To learn more about Gene interaction, refer to the link:
https://brainly.com/question/25217589
Describe and explain how the two types of white blood cells fight pathogens? 6 mark
Answer:
White Blood Cells Defend the Body Against Disease
Neutrophils are phagocytes, cells that consume invading pathogens. Lymphocytes, the second most common type of white blood cell, disseminate through the organs and tissues of the lymphatic system. Lymphocytes target specific pathogens as part of the immune response.
Explanation:
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Why is biodiversity important for ecosystems?
Answer:to stop from extinction
Explanation:
Which of the following solutions is neutral?
Group of answer choices
a solution with a pH of 14
a solution with a pH of 2
a solution with a pH of 7
a solution with a pH of 9
Flag this Question
Question 4
Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?
Group of answer choices
acid
base
neutral solution
pH indicator
first to answer gets the brinllest
Answer:
Kleenex
ekekkdkdkeeee
HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ
Answer:
01). cells
02).seeing inside the cells
03).Robert hook
