true or false
Only animals have a niche.

Answers

Answer 1

Answer:

False

Explanation:

Answer 2

Answer:

True

Explanation:


Related Questions

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply

A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year

B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest

C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest

D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores

E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one​

Answers

Answer:

The correct answer is - A and C,

Explanation:

According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:

The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.

B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.

Answer:

A, C, D

Explanation:

3. What is a type of asexual reproduction that com-
monly occurs in many species of unicellular pro-
tists? (1) external fertilization (2) tissue regenera-
tion (3) binary fission (4) vegetative propagation

Answers

Answer:

In fission (or binary fission), a parent separates into two or more individuals of about equal size. This type of reproduction is common among single-celled organisms including bacteria, archaea, and unicellular eukaryotes, such as protists and some fungi. The single cell divides into two daughter cells.Aug 17, 2016

Explanation:

the answer is binary fission

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

PLSS HELP ME!! NO LINKS!!


*fill in the blanks*

______ formation is caused by
dripping water shaping upside down
cones from cave roofs. This is an example
of________
(weathering, erosion,
or deposition)


________ formation is caused by a small amount of minerals dripping in the dissolved water during stalactite formation. This is an example of______ (weathering, erosion, or deposition)

Plss help me:(( i will give you BRAINLYEST!!

Answers

Answer:

1 stalactite

2 deposition

3 stalagmite

4 deposition

Explanation:

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

which involves producers, consumers, and decomposers?

the water cycle

nitrogen fixation

evaporation

the carbon and oxygen cycles​

Answers

I would say the carbon and oxygen cycles

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer: here ya go

Explanation: The lytic cycle is one of the two cycles of viral reproduction

Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.

Explanation:

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

Outline the process of the Carbon Cycle.

Answers

Answer:

Carbon Cycle Definition

Carbon cycle is the process where carbon compounds are interchanged among the biosphere, geosphere, pedosphere, hydrosphere, and atmosphere of the earth.

Carbon Cycle Steps

Following are the major steps involved in the process of the carbon cycle:

Carbon present in the atmosphere is absorbed by plants for photosynthesis.

These plants are then consumed by animals and carbon gets bioaccumulated into their bodies.

These animals and plants eventually die, and upon decomposing, carbon is released back into the atmosphere.

Some of the carbon that is not released back into the atmosphere eventually become fossil fuels.

These fossil fuels are then used for man-made activities, which pumps more carbon back into the atmosphere.

Hope it helps!!!

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Can someone tell me if it’s correct

Answers

Answer:

yes ur right

Explanation:

A student claims that the only difference between prokaryotic cells and eukaryotic cells is that
eukaryotic cells have a nucleus, but prokaryotic cells do not. What is wrong with this claim?

The description of the cell types is incorrect.

Prokaryotic cells have a nucleus, and eukaryotic cells do not.

The description of the cell types is incorrect. Both prokaryotic and eukaryotic cells have a nucleus.

There is another difference between the cell types. Eukaryotic cells have membrane-bound organelles, but
prokaryotic cells do not.

There is another difference between the cell types. Eukaryotic cells have a cell membrane, but prokaryotic
cells have a cell wall instead.

Answers

Explanation:

Eukaryotic cells:

• There is a well defined nucleus

• They are membrane bounded cell organelles like chloroplast, golgi bodies, mitochondria.

Prokaryotic cells:

• The nucleus are not well defined

• Cell organelles are not bounded by membrane

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

Which of the following represents the correct order of the phases of the
Moon?

A. new moon, full moon, last quarter, first quarter, and then new moon again

B. full moon, new moon, last quarter, first quarter, and then full moon again

C. full moon, last quarter, new moon, first quarter, and then full moon again

D. last quarter, full moon, new moon, first quarter, and then last quarter again

Answers

Answer:

c

Explanation:

full and new moons aren't back to baxk

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.

The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.

The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.

Answers

A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

What is a hypothesis?

An scientific hypothesis is a given explanation to a scientific observation from the real world.

A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.

In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

Learn more about hypotheses here:

https://brainly.com/question/11555274

#SPJ1

Other Questions
Sarah Turned on the soaker hose in her flower bed. The hose releases 192 gallons of water every 4 hours. If she leaves the hose on for 30 minutes how much water will be used? what would happen if you gave your dog a tiny piece of chocolate? . To buy a car, Mitchell borrowed $17,000 for 3 years at an annual simple interest rate of 9%. If it takes him 3 full years to pay off the loan, how much interest will he will pay for the car? * O $9,045 O $9,009,000 O $ $4590 O $459,000 2. Jaelyn deposits $750 into an account that yields 6.5% simple interest. How much will he in her account in 30 months if she door no 10 points On August 2, Jun Co. receives a $6,300, 90-day, 12% note from customer Ryan Albany as payment on his $6,300 account receivable. 1. Compute the maturity date for the above note. multiple choice October 29 October 30 October 31 November 1 November 2 True or False: There are only 2 sets of conjugations in the Imperfect Tense. List some of the external problems that China faced during the 1800s. (A few)_______ apartamentosUnas LasLosUnos Why were factories able to force workers to endure these conditions? What circumstances caused these conditions to exist and allowed it to continue? (3 4 sentence answer) Which expression is equivalent to (6^-2)^3 summarize Rebuilding the Old Order If u help u get brainliest and 15 points what is the result of subtracting the second equation from the first? 8x-4y=-4 -3x+4y=5 PLZZ HELP ME PLZ I NEED YALL HELP WITH THIS LAST QUESTION PLS ANSWER FAST WILL GIVE BRAINLY!!!!!!In the book "The Outsiders" In what ways are Cherry and Marcia different from each other? A factory owner might decide to manufacture shirts in Pakistan instead of the United States because A. it is less expensive to make shirts there.B. it is worth paying more for foreign labor.C. workers in Pakistan are more skilled.D. workers in Pakistan work fewer hours. A sociologist recorded the number of contacts entered in a cell phone and the number of texts sent in a week for 20 cell phone users. The resulting data were used to conduct a hypothesis test to investigate whether there is a linear relationship between the number of contacts and the number of texts sent. What are the correct hypotheses for the test?a. H0:1=0 Ha:10b. H0:1=0 Ha:1>0c. H0:1=0 Ha:1 help me plz............... Help me with this problem please Convert 25.4 grams of barium phosphate, Ba3(PO4)2 to formula units. how does a traditional economy differ from market economy