99% of the GMOs on the planet are ____
or ____
Answer:
The answer would be pesticide producers and herbicide resisters.
Explanation:
Hope this helped!
What do you know about carbon
Answer: We have it inside of our bodies
Explanation: Biology
Answer:
Carbon (from Latin: carbo "coal") is a chemical element with the symbol C and atomic number 6.
Explanation:
Hope it's help you !!!
What is the source of the carbon dioxide that is used in photosynthesis?
Answer:
Photosynthetic cells
Explanation:
photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen
The ___ of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The ___ of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, ____ either break or form.
Thus, water absorbs or releases a great deal of ____, helping to moderate temperatures.
Water is a versatile ____.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved ______.
Answer:
The polarity of water molecules and the hydrogen bonds between water molecules explain most of water's life-supporting properties.
The cohesion of water molecules to each other helps transport water from the roots to the leaves on plants.
When water warms or cools, hydrogen bonds either break or form.
Thus, water absorbs or releases a great deal of heat, helping to moderate temperatures.
Water is a versatile solvent.
Blood and other biological fluids are aqueous solutions with a diversity of dissolved solutes.
Explanation:
The sentences presented in the question above had their various spaces complemented by the words that best fit the sentence and that were capable of forming true invormations on water.
Water is a very versatile solvent as it is capable of dissolving and mixing with various substances both liquid and solid. Furthermore, water has a great capacity to absorb or release heat, which is very useful for the entire planet, as this allows water to be very efficient in regulating temperature.
Water is formed by H2O molecules, which hold these molecules together are the hydrogen bridges formed between them. Hydrogen bridges are broken through heat, which allows the water to evaporate, but at low temperatures these bridges are strengthened and new bridges can be created, which allows the water to become solid.
The properties of water are extremely important for life on the planet and for most biological processes we know about. Among these properties we can mention polarity and cohesion as one of the most important. Polarity allows water to be a polar substance, while cohesion allows water to create an attractive relationship between molecules.
Can someone please answer these multiple choice questions. (29 to 32) Will mark as brainliest.
What is the name of the supercontinent in Alfred Wegener’s continental drift hypothesis?
Answer:
Pangaea
Explanation:
Alfred Wegener proposed that the continents were once united into a single supercontinent named Pangaea, meaning all earth in ancient Greek. He suggested that Pangaea broke up long ago and that the continents then moved to their current positions. He called his hypothesis continental drift.
[tex]\sf\purple{Pangaea}[/tex] was the name of the supercontinent in Alfred Wegener’s continental drift hypothesis.
MORE:-Alfred Wegener is considered as the father of Continental Drift.This hypothesis was developed in the early part of the 20th century.Wegener proposed that the continents were once united into a single supercontinent named Pangaea. He also suggested that it broke apart long ago and the continents then moved to their current position.[tex]\large\mathfrak{{\pmb{\underline{\orange{Mystique }}{\orange{♡}}}}}[/tex]
Explain spermatogenesis and oogenesis.
Answer:
yep, my explanation
Explanation:
you see, it is a very dirty cycle, when you have a dioploid cell, you have your typical duplication of sister chromotids, but producing sex cells or gametes which would become a zygote through dirty interactions come to form one dioploid cell and it will start doubling like the rest of the human body, until it comes out of the other human's body. meiosis, or the formation of gamates are created with a crossover where one diolpoid cell takes one half of the chromosome and the other half and exchange a tiny bit of it before splitting into 2 DIFFERENT gametes cells because of the cross-over and hence ther term natural selection
What are the phenotypes of an organism?
A. the organism's genes
B. the organism's physical traits
B. the organism's physical traits
hope it is helpful to you ☺️
I believe the answer to this is:
B. The organism's physical traits
Hope this helps! :D
The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?
Answer:
3' GGACTTAA 5'
Explanation:
because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage
Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.
Answer:
Yes, Mrs Green is correct that Belle is her biological daughter
Explanation:
According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.
Based on the blood analysis, the following were obtained:
Mr. Green: Type A
Mrs. Green: Type A
Georgia: Type A
Mr. Blue: Type AB
Mrs. Blue: Type A
Belle: Type O
The genotype of the following blood types is as follows:
Type A - iAiA or iAi
Type B - iBiB or iBi
Type O - ii
Type AB - iAiB
From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.
However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.
How does convection cause ocean currents?
A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.
B. During the process of convection, the heating of surface water by the sun results in upwelling.
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink.
Answer:
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
Explanation:
Convection refers to the process of transference of heat from one place to another by the movement of gas/liquid particles. Convection occurs when a gas or liquid substance is heated, thereby it expands (increase its volume) by gaining kinetic energy and moving far apart. Energy in the atmosphere and oceans is transferred mainly by convection. In the atmosphere, convection produces wind belts. Moreover, an ocean current is the result of the continuous movement of seawater caused by different forces acting upon the water (i.e., wind, the Coriolis effect, waves, temperature). In the oceans, convection produces currents because the seawater heats up becoming less dense and moves above cooler seawater, emitting heat during the process and causing the continual circulation of water.
Answer:
c
Explanation:
The male tubes that transport sperm from the testes are called?
Answer:
The epididymis is the tube that moves the sperm from the testicles.
Answer:
epididymis
Explanation:
1. Lactose takes years to break down on its own. But if exposed to the protein lactase, the reaction proceeds very quickly, while lactase itself remains unchanged. Lactase is an example of a(n) . 2. A(n) is a molecule that can bind to an enzyme and prevent the enzyme from working. There are two types: a(n) binds to the active site of the enzyme; a(n) binds elsewhere on the enzyme. 3. Enzymes speed up chemical reactions by lowering the , which allows the reaction to proceed much more quickly. 4. During an enzymatic reaction, a molecule of binds to the enzyme and is broken down into one or more molecules of , which are released. 5. The specific location within an enzyme molecule where the substrate binds is called the .
Answer:
1.) Lactase is an example of ENZYME.
2.)An INHIBITOR is a molecule that can bind to an enzyme and prevent the enzyme from working.
3.)Enzymes speed up chemical reactions by lowering the ACTIVATION ENERGY,
4.) a molecule of SUBSTRATE binds to the enzyme and is broken down into one or more molecules of PRODUCT which are released.
5.) The specific location within an enzyme molecule where the substrate binds is called the ACTIVE SITE.
Explanation:
An enzyme is defined as the substances that aids in the breaking down of complex food substances, taken in by animals, into simple, soluble and diffusible substances before they can be absorbed into the body. In the enzymatic reactions, a molecule of SUBSTRATE binds to the ACTIVE SITE of an enzyme and is broken down into one or more molecules of PRODUCT which are released.
There are different types of enzymes which are named according to the type of good they digest, these include:
--> Lactase: breaks down Lactose
--> proteases: breaks down proteins
--> Amylases: breaks down carbohydrate
Enzymes have the following characteristics:
--> They are proteins
--> They are specific in action. For example Lactase can only act on lactose.
--> They can be inactivated by INHIBITORS.
--> They are sensitive to temperature
--> They speed up a reaction by lowering the ACTIVATION ENERGY
please help meeeeeeeeeee.
Answer:
T = A
A = U
G = C
A = U
A = U
C = G
draw any two microbes
In the attachment are some examples:
write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond
(See the attached picture)
Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.
Answer:The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.
The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.
Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.
Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.
I hope it helps!!The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.
How is the zygote formed and developed?The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.
The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.
Hence, all of these events occurred from the zygote to the child's maturity.
Learn more about the zygote here.
https://brainly.com/question/465851
#SPJ2
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
Which process produces genetically identical cells?
A. Meiosis
B. Mitosis
Answer:
mitosis produce genetically identical cells
Answer:
B mitosis i think .......
Give 2 advantages that mammals have over reptiles. Explain.
Answer:
warm-bloodedness is the main one
Explanation:
Answer:
1) Being warm-blooded gives mammals a distinct advantage in habitats
2) Mammals are important members of food chains and food webs, as grazers and predators.
3) Mammals meet people's needs by serving as pets, transport, food, or research subjects.
4) Mammals also interact with other species in many symbiotic relationships.
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
What does the prefix "hetero-" mean?
A. Same
B. Different
Answer:
B. Different
Explanation:
Which of the following best describes the function of the human nervous system?
Answer:
The nervous system gathers, interprets, and responds to information about the body's internal and external environment.
A person living in a coma is considered living or dead?
Answer:
Someone who is in a coma is unconscious and will not respond to voices, other sounds, or any sort of activity going on nearby. The person is still alive, but the brain is functioning at its lowest stage of alertness.
GIVE BRAINLIEST!!! PPS HELPPPO
Answer:
50%
Explanation:
Water that is dense will float while water that is less dense will sink.
True or false ?
Answer:
If an object is more dense than water it will sink when placed in water, and if it is less dense than water it will float.
Name two traits that the most recent common ancestor of a whale and a human probably had.
Answer:
Their ancestor is most likely an ancient artiodactyl, i.e. a four-legged, even-toed hoofed ... However, whales, like humans, are mammals.
Explanation:
hope it help u
Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above
Answer:
d
Explanation:
Pls answer I will help you out. Need this for tmr
Answer:
uhh
Explanation:
sorry i dont know
Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.Which plants should the farmers cross to get the desired (wanted) combination of traits
Answer:
cultivated plant variety with its wild type variety.
Explanation:
The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.
The owner of a white female poodle wants her dog to have white puppies. she takes her dog to a breeder, who tells her he will mate her poodle with a white male. Much to the owner's surprise, her poodle gives birth to a black male instead of a white one. she is suing the breeder, alleging he mated her poodle with a black male instead of a white one, which resulted in six unwanted black puppies. You know that the white hair allele is recessive to the dominant allele for black hair in poodles. would you support the owner's allegation? explain your answer.
