What are emergent properties?

Answers

Answer 1

Answer:

Emerging properties may arise by transient interactions such as individual organisms building a population. Human interaction in populations leads to the emergence of language, poetry, musical composition, and art. When populations of different species interact, communities form. Many emergent properties are the result of interactions between species in communities.

Answer 2

Emergent properties are characteristics of a system that do not exist in any of its constituent parts individually but originate as a result of interactions between those parts.

What does the characters indicate at ?

These characteristics are frequently intricate and challenging to forecast. Emergent characteristics are a crucial idea in several disciplines, including physics, chemistry, and biology.

Emergent qualities in biology can be observed in an organism's behaviour. For instance, a flock of birds' behaviour is an emergent characteristic of the individual birds that make up the flock.

The behaviour of the flock is a product of interactions among the individual birds and is not exhibited by any one individual bird. Similar to this, a school of fish's behaviour is an emergent characteristic of each fish.

Emergent features in chemistry can be observed in how molecules behave. An emergent attribute of a substance's individual molecules, for instance, is the substance's boiling point. The boiling point is not a property of any one molecule, but rather the outcome of interactions between the molecules.

Particle behaviour in physics exhibits emergent features. An emergent attribute of a material's individual particles, for instance, is the material's electrical conductivity.

The interactions between the individual particles produce the electrical conductivity, which is not a property of any one of the individual particles. As a result, emergent properties are characteristics of a system that develop.

Learn more about emergent properties at:

https://brainly.com/question/28014984

#SPJ2


Related Questions

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

If a vaccine protects you for most of your life against a particular pathogen, why do you need a new flu shot every year? A. Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it. B. Influenza is so strong that you need a booster every year to make sure your body can fight it. C. Influenza is a virus, and vaccines only generate memory cells for bacterial infections. D. You don’t need it every year, it is just offered every year for anyone who does not have it yet.

Answers

Answer:

If you got a flu shot this year, next year you'll need it again.

Explanation:

This is because the virus changes, usually rendering the previous year's vaccine partly or totally useless. hope this helps you :)

Answer:

A.

Explanation:

Influenza evolves very quickly and its antigens mutate so that your memory cells from the last vaccine won’t recognize it.

The 2020 influenza vaccine was not as efficient because scientists were scrambling to put out a vaccine for Coronavirus. Consequently, Coronavirus cases skyrocketed during the flu season.
Hope this helped!

also.. i have to put coronavirus and not "c0vid-19" because apparently it's too political. lol.

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Tara placed a grape in a solution, after sometime she noticed that the grape started to shrink.
a. Name the solution and explain.
b. Then Tara placed the raisin in a solution and noticed it started to swell up. Name the solution and explain

Answers

Answer:

a. Hypertonic solution

b. Hypotonic solution

Explanation:

There are basically 3 types of solutions in biology,

1) Isotonic-Same concentration of solute and solvent inside  the grape and in the solution.

2)Hypotonic solution-More concentration of solvent in the solution than in the grape.

3)Hypertonic solution-More concentration of solvent in the grape than in the solution.

Now,

a. Tara had kept the grape in a hypertonic solution. The solvent will start draining from the grape to equalize the concentrations of solvent inside and outside. So, the grape shrank due to loss of water.

b. Tara kept it in a hypotonic solution. The solvent will start entering the grape to equalize the concentrations of solvent. So, the grape started swelling.

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

A possible answer to a scientific question that can be tested is a

Answers

The key to a good and manageable investigation is to choose a topic of interest, then ask what is called a “testable question.” Testable questions are those that can be answered through hands-on investigation by the student.

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

please answer the question​

Answers

Answer:

two of the DNA fingerprint are same when they contain the same nitrogenous bases in the same location of the DNA.

Explanation:

The DNA fingerprint is one of the most important tool as a forensic medicine expert to to form such condition and rule it out to come to a diagnosis.

DNA fingerprint uses the base pair which a different for all the other human beings. Due to this from the blood or other cells of the body there can be an evidence of the person and this is usually done on a comparative basis.

To know more about DNA fingerprint,

what is DNA fingerprinting? - Brainly.in

brainly.in/question/3388325

HOPE IT HELPS!!!

MARK IT BRAINLIEST!!!!

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

The __________ is a layer of cells that surrounds an axon and helps to accelerate the transmission of information. a: soma b: nerve c: myelin sheath d: axon terminal

Answers

Answer:

C: myelin

Explanation:

its the substance that surrounds nerve cell axons

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Other Questions
cual es el area de un rectangulo 5/9 of a piece of metal has a mass of 7 kg. What isthe mass of the piece of metal?No wrong answer or else I will report 2.PART B: Which detail from the story best supports the answer to PART A?A. "They talk by flapping their meat at each other. They can even sing by squirtingair through their meat." (Paragraph 31)B. **Officially, we are required to contact, welcome and log in any and all sentientraces or multibeings in this quadrant of the Universe" (Paragraph 35)C. "It seems harsh, but there is a limit. Do we really want to make contact withmeat?'" (Paragraph 37)D."We went into their heads and smoothed out their meat so that we're just adream to them."" (Paragraph 43) Sarah has many dreams and just as many goals. But she is challenged to translate her academic goals into behaviors that will support her success. If you were giving Sarah advice, what would you recommend Hotel Cortez is an all-equity firm that has 10,900 shares of stock outstanding at a market price of $37 per share. The firm's management has decided to issue $66,000 worth of debt and use the funds to repurchase shares of the outstanding stock. The interest rate on the debt will be 8 percent. What is the break-even EBIT Which of the following was not a part of the Northern industry? A.lumber B. Shipping C. Textiles D.cotton What is the decimal equivalent of 16/3 ?A. 5.3B. 0.1875C. 53333...D. 16.3 What is the correct evaluation of x2 - y2 - z2, when x is equal to -2, y is equal to 3 and z is equal to 4? 1+3^225 order of operations There are 45 eighth graders and 20 seventh graders in a school club. The president of this club wants 40% of the clubs members to be seventh graders. How many more seventh-graders must join the club in order to meet the presidents wishes? (Assume that the number of eighth-graders remains the same.) Midhun uses internet to deposit 1 poinand withdraw money from hisbank. Name this type ofbanking.e-commerceO e-bankingO e-paymentO e-lending A set of circular cups are placed so that they are touching rim to rim, as close together as possible. It is not possible to fit more cups inside the group if the longest straight line is five cups long, how many cups are there altogether? A classroom has 35 students. If the ratio of boys to girls was 5:2, , how many girls were in the class Which is the simplified form of the expression ((2 Superscript negative 2 Baseline) (3 Superscript 4 Baseline)) Superscript negative 3 Baseline times ((2 Superscript negative 3 Baseline) (3 squared)) squared? Because Copland worked to build cultural bridges between East and West, he was investigated under suspicion that he was a(n) __________. Jake remembers his grandfather telling him about going to work at 16 years of age in the coal mines of southern Illinois. In order to get the job, he had to agree to a yellow-dog contract. Essentially this meant he would only get the job if he agreed not to join a union.A. TrueB. False what type of environment would you most likely find fish species 1? how do you run a function in python? why do you think india and pakistan were so concerned about winning the accession of the various princely states? Which equation can be used to find x, the length of the hypotenuse of the right triangle?