what are some quotes that show romeo's actions/attitudes in romeo and juliet?

i need 5 in total, please help

Answers

Answer 1

1. "I defy you, stars!"

2. "Oh, I am fortune's fool!"

3. "Thy beauty hath made me effeminate."

4. "Then move not, while my prayer's effect I take."

5. "Villain am I none."


Related Questions

The girls, how does this poem describes gender norms for women’s

Answers

Answer:

That women are objects to men and can just be thrown away when they are bored

Explanation:

Select the correct answer.
What is the overarching goal of active reading?
A.
To engage with a text
B.
To highlight passages to remember
C.
To find answers to test questions
D.
To get good quotes for papers

Answers

Answer:

B. To highlight passages to remember

B. Because if your gonna find answers to need to highlight the passages so you can flip back to the pages.

Exercising has a positive (effect, affect) on your health.

Answers

Answer:

Effect

Explanation:

Elements of Poetry
Question 1
Which statement describes a major difference between a traditional poem and a free verse poem?
O
A traditional poem may contain alliteration, but a free verse poem does not
contain this sound device.
A traditional poem may contain regular meter and rhyme scheme, but a free
verse poem does not contain these elements.
O
A traditional poem may contain rhyme and figurative language, but a free verse
poem does not contain these elements,
A traditional poem may contain imagery, but a free verse poem does not relay
vivid images to the reader.

Answers

Answer: A traditional poem may contain regular meter and rhyme scheme, but a free verse poem does not contain these elements.

Explanation: Free verse poems do not contain a regular meter nor do they contain a rhyme scheme because they are free verse so you can do whatever you want without abiding by the rules of poem literature

Which statement uses the correct MLA in-text citation?

Answers

The statement that uses the correct MLA in-text citation would be A. This is the case because MLA in-text citations are inserted in the body of the text. They include the last name of the author followed by the page number in parentehesis. For instance, "this is a quotation"

Which sentence revise the best enemas of the story setting

Answers

Answer:

There’s no story, sentences, or answers. Try retrying this answer.

According to the article, what were some of the factors that contributed to the quality of network news in the middle of the 20th century? (Springboard English 4 pg. 275)

Answers

In the twentieth century, TV station initiative accepted that giving news was a public help. News wasn't supposed to bring in cash for public telecasters.

What was the concern in twentieth century about media?

Numerous present worries about the news can be followed back to long haul changes that started as soon as the 1960s and sped up during the 1980s, when media organizations were purchased by huge combinations and chains, and expanding media fixation turned into a logically bigger issue.

In the twentieth century, TV station initiative accepted that giving news was a public help. News wasn't supposed to bring in cash for public telecasters. During that time CBS, for instance, developed a top notch news division, with separated columnists like Edward R. Murrow.

For more information about twentieth century, refer the following link:

https://brainly.com/question/16405142


1. On March 21 1985, our community held its bicentennial.
2. On March 21, 1985, our community held its bicentennial.
3. On March 21, 1985 our community held its bicentennial.
4. On March 21, 1985 our community, held its bicentennial.​

Answers

It’s 2 since there is a comma after 21 and 1985.

Today, alternative energy is the buzzword of the nation. Millions of dollars of research money are going into so-called "green" technologies that are supposed to be more environmentally friendly. Although it is nice to think that we can save the planet by driving "green" cars, that simply isn't true. We cannot get something for nothing.

Select two words from the paragraph that intended to get the reader thinking of green technologies in a negative light. Type in the letter choices of TWO words in the box below:
A. alternative
B. buzzword
C. research
D. so-called
E. environmentally
F. planet

Answers

The right answer is f and e

Choose the correct adverb for the sentence.
Tread the report
than Dave.
A.
more quickly
B.
most quickly
C. quick
D. quickly

Answers

Answer:

I think it's D quickly is an adverb

Answer:

the answer is letter A...

5. Do you agree that the pandemic served as an awakening call to all of us? Why or
why not?​

Answers

Answer:

Yes, I agree that the pandemic served as an awakening call to all of us. It is because it has helped communities to come together and understand the ultimate bond they share.

Explanation:

With the spread of the novel coronavirus disease globally, people have become more connected with each other. Therefore, one can say that this pandemic has served the purpose of an awakening call to humanity.

As the disease spread globally, all the communities shared an ultimate bond of common fate. People are awakening to call that they all share a common destiny. This pandemic also has awakened to the truth of the failure of our institutions on which we depend.

Therefore, I agree with the statement.

Help plsssssssssssssssssssssss thanks so much ㋛

Answers

Answer:

A

Explanation:

Which statements describe a text with an argumentative structure? Select three options.

Answers

Answer:

I would but

Explanation:

There is no 3 options

PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.

True
False

Answers

Answer:

true

Explanation:

In the 1600s , the Angelic church was seemed as a treachery because some of it's structure does not fit the Traditional Catholic ( which was was imposed on all England). John Bunyan is one of the most famous Anglican Minister in the Era. A lot of European Angelic Churches honor his death on every August 31st 

Answer:

True

Explanation:

Which of the following statements best describes a major theme of the poem? Mother to Son Poem.

Answers

Answer:

"Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

Explanation:

hope i answer your question right

"Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

What is noun?

The best definition of an appositive is a noun or noun phrase that modifies a noun. This grammatical construction usually sits next to another noun and modifies it by renaming it or describing it in another way. Appositives are generally offset with commas or dashes. For example: My best friend, Gary, lost his keys.

Common nouns are nouns that name a class of person, place, thing, animal or event in a general way (they do not refer to someone or something in specific as proper nouns do), and that are not to be capitalized unless they begin a sentence or are part of a title. The term report, then, is a common noun because it refers to a class of thing or of piece of information, and is not to be capitalized.

Therefore, "Mother to Son" is a 1922 poem written by Langston Hughes. The poem follows a mother speaking to her son about her life, which she says "ain't been no crystal stair". She first describes the struggles she has faced and then urges him to continue moving forward.

Learn more about  crystal on:

https://brainly.com/question/13008800

#SPJ2

You guys are the toughest bunch of soldiers ever, and you
deserve every good thing that comes your way!
Which best explains why the tone is inappropriate for the audience?
A. It is disorganized and too solemn.
B. It is lacking in passion and gratefulness.
O C. It is too casual, and the references are vague.
O D. It is too poetic and not formal enough.

Answers

Answer:

B

Explanation:

The tone of the essay is a reflection of the writer's attitude towards its topic matter. The address to the world war II veterans seems too poetic and informal. Thus, option D is correct.

What is tone?

A tone is a depiction of the attitude of the speaker or the writer with its words and phrases that express their feelings, and thoughts towards the topic issue and the matter.

Here, the address for the veterans sounds poetic and is not delivered in a formal tone. A formal tone is a type of tone that is direct, without slang, and uses respectful words to show the professional context.

Therefore, the tone is inappropriate as it is not formal.

Learn more about formal tone here:

https://brainly.com/question/14976548

#SPJ2

Why can't we force our emotions when we are truly happy?

Answers

Answer:

Emotions come from within and how we feel, also how we interact with those around us.

Example:

If you are alone in a dark room you will most likely be scared, or if you are in a bright colored room with people you like you will most likely be happy or neutral.

Choose the correct adverb for the sentence.
We counted the inventory
than the others.
A.
more quickly
B.
most quickly
C.
quickly
D.
quicker

Answers

Answer:

quicker makes the most sense. the answer is quicker.

In the final sentence of the passage, the pairing of the verbs "balanced" and "leaped" suggest what fine distinction regarding the character of Altaf? He is uncomfortable back in a village that he barely knows. He is uncomfortable back in a village that he barely knows. A He is finally secure in his decision to return home. He is finally secure in his decision to return home. B He looks forward to a happy reunion with his neglected family. He looks forward to a happy reunion with his neglected family. C He relishes his celebrity with the children and mimics their play. He relishes his celebrity with the children and mimics their play. D He is poised between two worlds but eager to be home.

Answers

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

As per the context(background) of the given passage, the author pairs verbs like 'balanced' along with 'leaped' to signal that although Altaf was composed under the two different worlds yet he wished to return to his home. The use of words like 'balance' symbolizes the readers that he was in a calm and assured disposition while the word 'leaped' signifies his delight and excitement to return to his home.  Thus, the most appropriate option D is the correct answer.

Answer:

D). He is poised between two worlds but eager to be home.

Explanation:

According to the passage, the pairing verbs "balanced" and "leaped" :

The creator sets action words like 'adjusted' alongside 'jumped' to flag that in spite of the fact that Altaf was made under the two unique universes yet he wished to get back to his home. The utilization of words like 'balance' represents the perusers that he was in a quiet and guaranteed attitude while the word 'jumped' means his enjoyment and fervor to get back to his home.

Thus, the most appropriate option is D .

Know more :

https://brainly.com/question/924945?referrer=searchResults


Which of the following sentences uses the pronoun correctly?
A.
Dwight is a person who has trouble making up his mind.
B. Dwight is a person who has trouble making up their minds.

Answers

Which of the following sentences uses the pronoun correctly?

Answer : A.

Dwight is a person who has trouble making up his mind.

Answer:

B. Dwight is a person who has trouble making up their minds

this is correctly pronoun

I hope it's helpful for you.....

Review the selection. Which of the following is the author's purpose in writing this selection?
Multiple Choice
to Inform
to Instruct
O
to entertain
O
to persuade

Answers

Answer:

To inform

Explanation:

It talks about how the person don't like certain things and how he dose things his own ways.

What is the sentence structure? Because he needs to improve his grades,Joesph after-school tutoring, and he worked harder on his homework.

Answers

Answer:

The structure of the sentence provided is C) compound-complex.

Explanation:

How does the first-person point of view of the speaker contribute to the meaning of the poem Urania

Answers

The first-person point of view of the speaker contribute to the meaning of the poem Urania because the speaker includes himself as someone who has disappointed Urania.

How does the first-person point of view contribute a meaning?

The speaker used himself as an example of disappointment to make him an integral part of the storyTo also have a share of the experience on how men treat woman

Therefore, The first-person point of view of the speaker contribute to the meaning of the poem Urania because the speaker includes himself as someone who has disappointed Urania.

Learn more on Urania below

https://brainly.com/question/24606277

#SPJ1

Glen is writing about the benefits of using digital textbooks. He must review his writing and check for sentence structure. His teacher noted some phrases and clauses that do not create complete sentences.

Benefits of Digital Textbooks
For decades, students have used print textbooks in the classroom. Making textbook publishing a huge industry in the United States. As tablets have become more popular. School districts debate whether they should switch from print textbooks to digital textbooks on tablets. Those who want digital textbooks say that tablets can hold more content in a small amount of space and that using a tablet is more intuitive than a textbook for students today. They also argue that digital textbooks are cheaper than print textbooks.

Did you know that hundreds of textbooks can be downloaded on a single tablet? In addition, class notes, homework, tests, and other files can be stored on the tablet, eliminating the need for paper and other materials in the classroom.

Digital textbooks cost less than print textbooks. An average 6-year subscription to a digital textbook is $45 to $55; while the average price of a print textbook is approximately $70. Trends show that while the cost of print textbooks continues to rise, digital textbook prices continue to drop.

Glen is writing about the benefits of using digital textbooks. He must review his writing and check for sentence structure. His teacher noted some phrases and clauses that do not create complete sentences.

Benefits of Digital Textbooks
For decades, students have used print textbooks in the classroom. Making textbook publishing a huge industry in the United States. As tablets have become more popular. School districts debate whether they should switch from print textbooks to digital textbooks on tablets. Those who want digital textbooks say that tablets can hold more content in a small amount of space and that using a tablet is more intuitive than a textbook for students today. They also argue that digital textbooks are cheaper than print textbooks.

Did you know that hundreds of textbooks can be downloaded on a single tablet? In addition, class notes, homework, tests, and other files can be stored on the tablet, eliminating the need for paper and other materials in the classroom.

Digital textbooks cost less than print textbooks. An average 6-year subscription to a digital textbook is $45 to $55; while the average price of a print textbook is approximately $70. Trends show that while the cost of print textbooks continues to rise, digital textbook prices continue to drop.

Research shows that students learn faster when using tablets. According to the US Department of Education and studies by the National Training and Simulation Association, students take 30–80% less time to reach a learning objective with technology-based instruction.

Answers

Answer:

The first two options are correct.

Explanation:

"Making textbook publishing a huge industry in the United States. As tablets have become more popular."

Answer:

making text book... united states

As tablets...popular

Explanation:

i got it right

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

Valley forge: would you have quit?

Question: how could this document be used to argue for quitting?

Answers

Answer:

is this a book? Please tell if so.

What would a possible food chain look like

Answers

Sun->grass->rabbit->fox
This is because energy is used from the sun to grow grass then the grass is eaten by the rabbit. Then the fox eats the rabbit

In which sentence were the commas used correctly before and after the appositives?

After the pep-rally, a player celebration we walked to the game.

After the pep-rally a player celebration, we walked to the game.

After the pep-rally a player celebration, we walked to, the game.

After the pep-rally, a player celebration, we walked to the game.

Answers

Last one after pep-rally .

4. Lynda has a coupon that offers $0.35 off the price of a
box of cereal. The cereal sells for $3.29. How much will
the box of cereal cost if Lynda uses the coupon?

Answers

2.94 (you need to subtract 0.35 from 3.29 to get the answer

Answer:

2.94

Explanation:

subtract 3.29 and 0.35

14 17 20 please helppppppp!!!!!!!!!!!

Answers

Answer:

14: The answer is B

17: The answer is A

20: Th answer is C

Answer:

Explanation:

14 is B

17 is A

20 is C

Other Questions
PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! When McCandless is working for Wayne Westerberg in Carthage, South Dakota, Westerberg thinks that McCandlessA.is lazyB.is addicted to drugsC.is probably mentally illD.is one of the hardest workers he has ever seenE.is a genius and an artist An owl swoops down when it sees prey. In this scenario, what is the stimulus and what is the response? What is correct regarding trans fatty acids Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1) Item 3How does the setting of the afterlife in "Orpheus and Eurydice" differ from that in "Valhalla: Hall of the Chosen Slain"?In "Orpheus and Eurydice," the afterlife is about punishment, while in "Valhalla: Hall of the Chosen Slain," it is based on pleasure.In "Orpheus and Eurydice," the afterlife is like a vacation, while in "Valhalla: Hall of the Chosen Slain," it is nothing but hard work.In "Orpheus and Eurydice," the afterlife is torturous, while in "Valhalla: Hall of the Chosen Slain," it is relaxing.In "Orpheus and Eurydice," the afterlife is gloomy and calm, while in "Valhalla: Hall of the Chosen Slain," it is wild and riotous. hi can you please help me with my work When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough? Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Classify the real number.[tex] \sqrt{15} [/tex] Please help! Thank you! The image below shows anti-Castro forces launching an attack during the Bay of Pigs invasion in 1961. What type of response does this image illustrate? Diplomacy Isolation Intervention Trade Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2