Answer:
2a and -5a
8 and -4
hahahah they are separate from each other
2a and -5a simplifies to -3a
8 and -4 simplifies to 4
Explanation:
hope this helps!
What increases as you move from the surface to the interior of the Earth?
Answer:
Heat/temperature
Explanation:
"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
6. A characteristic common to both diffusion and active transport is that
the movement of molecules occurs
energy is needed
oxygen is moved across a membrane
O
molecules move from low concentration to high concentration
Answer:
oxygen is moved across a membrane O, cause the others are untrue.
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
PLEASE HELPPPPPPP
(Monstro the Goldfish & Epigenetics)
Answer:
mmmmmmmmmmmmdddddd
Explanation:
ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
1. Energy transfer is inefficient between trophic levels because
A. Molecules are fully digested from each trophic level.
B. Dead organisms and waste are recycled throughout the trophic levels.
C. Organisms within a trophic level are fully consumed.
D. All organisms within a trophic level die.
2. Primary productivity is defined as
A. The rate that plants and other photosynthesis organisms produce organic compounds.
B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.
C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.
D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.
Thanks if you help, It's highly appreciated. :-)
Answer: b dead organisms And waste are recycled throughout the tropic levels.
Explanation:
Answer:
part 2
the rate that plants and other photosynthetic organisms produce organic compounds.
Explanation:
:)
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
(GIVING BRAINLIEST) ______________ energy is the total potential and kinetic energy of particles in an object.
Group of answer choices
Chemical
Nuclear
Thermal
Answer:
Thermal
Explanation:
The total kinetic and potential energy of the particles in an object is called thermal energy.
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
please answer this!!
Answer:
mouth coughing out biok sid carbon
What change to the following molecule's structure would result in a saturated fat?
Answer:
It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.
Explanation:
Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.
Hope this helped :)
Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D
Answer:
C
Explanation:
it has the example figure number 7 and also it has the correct bisector
Can someone please help me
Answer:
carbon dioxide plus water in the presence of light energy to sugar and oxygen
o
1. Which criteria are used to classify amphibians into orders?
Answer:
They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
Why do disruptive selection pressures tend to favor rapid evolutionary changes?
a. They result in sudden gene frequency changes.
b. They eliminate extreme genetic traits.
c. They select for one variation of a genetic trait.
d. They result in environmental adaptation.
Answer:
The correct answer is a. They result in sudden gene frequency changes.
Explanation:
The evolution of life, its diversity, is reduced to the processes of microevolution or speciation. But not all evolutionary processes in populations end with the formation of a new species. Disruptive selection is a type of natural selection that selects against the average individual in a population. The composition of this type of population would show phenotypes (individuals with groups of traits) of both extremes but with very few individuals in between. Disruptive selection tends to increase intra-population variability and, to this end, favors individuals at both ends of the phenotypic distribution, that is, as a final result there is a break in two different populations, which can lead to speciation.
Answer:
A"They result in sudden gene frequency changes."Explanation:
just took the test for edg and got it right
PLSPLSPLS HELP ASAP
a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.
In what two ways can the minnow population be used to monitor the Lakes water quality?
Answer:
In the above case we can understand that,
If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.Answer: The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."
Explanation:
I got it right.
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
which is NOT part of the cell theory?
A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things
Answer:
B.
Explanation: Hope this helps! ^^
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
