What are the main issues to be addressed in a business code of ethics required by the Securities and Exchange Commission

Answers

Answer 1

Answer:

Conflicts of interest, full and fair disclosures, legal compliance, internal reporting of code violations and accountability.

Explanation:

The main issues to be addressed in a business code of ethics as required by SEC securities and exchange commission are conflicts of interest, full and fair disclosures, legal compliance , internal reporting of code violations and accountability.

With regards to the above, businesses are expected to fully disclose conflict of interest if there is any to SEC. The reason is to monitor the activities of the business whether it has deviated from its original plan. Again, it is expected of business to completely disclose facts as it relates to its dealings with members of the public in a fair manner.

Again, a business as required by SEC must comply legally to the regulations as instituted by relevant governing bodies. A business must also be accountable at all times for its actions or inactions.


Related Questions

1. Values in a chart must be:
Select the correct option.
O a. Numbers
O b. Words
O c. Months
O d. Columns

Answers

Answer:

a. Numbers

Explanation:

The values in a chart represent data. Anyone reading a chart should be able to interpret the information presented with relative ease. Due to the space factors, the values of a chart are always in numbers.  Values in number form take little space compared to words.

Numbers are clear and easy to understand for everyone. When a value is very big, writing it in words may pose a challenge for some people to understand.

the real risk rate of interest is 2.5% and inflation is expected to be 3% this year and 3.5 during the next three years assume that the maturity risk premium is Sarah what is the yield on 4 year treasury securities

Answers

Answer:

5.875%

Explanation:

Yield on 4 year security = real risk free rate + average inflation over 4 years

average inflation over 4 years = (3% + 3.5% +  3.5% + 3.5% ) / 4 = 3.375%

3.375% + 2.5% = 5.875%

A company reported average total assets of $1,240,000 in Year 1 and $1,510,000 in Year 2. Its net operating cash flow was $102,920 in Year 1 and $138,920 in Year 2. (1) Calculate its cash flow on total assets ratio for both years. (2) Did its cash flow on total assets improve in Year 2 versus Year 1

Answers

Answer:

A. Year 1 8.3%

Year 2 9.2%

B. Yes

Explanation:

(1) Calculation for its cash flow on total assets ratio for both years

Using this formula

Cash flow on total assets ratio =Net operating cash flow/Average total assets

Let plug in the formula

Year 1 Cash flow on total assets ratio=$102,920/$1,240,000

Year 1 Cash flow on total assets ratio=8.3%

Year 2 Cash flow on total assets ratio= 138,920/1,510,000

Year 2 Cash flow on total assets ratio= 9.2%

(2) Based on the above calculation YES it's cash flow on total assets improve in Year 2 versus Year 1

Guys I need a kawaii Username for YT the person that had the best one I will crown branliest I'm giving 40 points!

Answers

Answer:

Sweetlolipie

Explanation:

Answer:

What about "TedyBear","PixelII" and "PoohBear"???

Select the following three roles in a business that do not carry personal liability for any judgments against the company.

the owner in a sole proprietorship
a limited partner in a partnership
a general partner
a corporation shareholder
the CEO of a major corporation

Answers

Answer:

first third and fourth

Explanation:

saw it on quizlet

The nominal interest rate is 7% and the expected inflation rate is 2%. Based on the Fisher effect, the real rate of interest is Group of answer choices 5.0% 5.1% 4.9% 6.86%

Answers

The answer:
5.1%
Trust me:] and good luck!

what is taxable incomeTanya (born 10-31-90) is single, has no dependents and will not itemize deductions. She cannot be claimed as a dependent by anyone else. Tanya can claim adjustments of $800 for her student loan and $1200 for an IRA. She had the following income: Wages $22,594

Answers

Answer:

Interests on student loans and IRA contributions are above the line deductions, which means that they decrease a person's AGI before they take any itemized or standard deduction.

Tanya's AGI before taking any deduction = $22,594 - $2,000 = $20,594

Assuming that she is filing her 2020 taxes, the standard deduction for single filers is $12,400, so her total taxable income = $20,594 - $12,400 = $8,194.

Explain the problems a hotel faces in making the following departments profitable: restaurants, bars, and room service

Answers

Answer: A successful strategy is to show guests the restaurants and explain the cuisine before they go to their rooms, which has prompted more guests to dine in the restaurants during their stay...The best way to prevent these occurrances is to have a good control system, which should include people who are paid to use the bar like regular guests, but are really there to check on the bartenders.

Explanation:

Restaurants; hotel guests are not always predictable. Sometimes they will use the hotel restauraunts, and other times they will dine out. A successful strategy is to show guests the restaurants and explain the cuisine before they go to their rooms, which has prompted more guests to dine in the restaurants during their stay.

Bar; Bars is measured by the pour/cost percentage. Post cost is obtained by dividing the cost of depleted inventory by sales over a period of time. Operations with lower pour costs have more sophisticated control systems and a higher-volume catering operation. Some bartenders tend to overpour measures to receive larger tips. The best way to prevent these occurrances is to have a good control system, which should include people who are paid to use the bar like regular guests, but are really there to check on the bartenders.

Imagine that you own a small hardware store and need to price several new items. What legal considerations would you need to take when pricing these items

Answers

Answer:

The legal considerations that would be taken into account when pricing items in a small hardware store are:

1. Predatory pricing: This strategy prices items very low for the purpose of eliminating competition. It is illegal.  Since predatory pricing violates antitrust laws, it causes the rising of monopolistic markets and the creation of monopolies.  The allegations of predatory pricing are usually hard to prove because of the counter-argument that it could be part of normal competition.

2. Price discrimination:  The Robinson-Patman act prohibits price discrimination or the attempt of companies to sell the same goods at different prices to different consumers.

3. Both predatory pricing and price discrimination because of their negative economic consequences are regarded as deliberate moves by business entities to undermine the marketplace and the forces of demand and supply.  They are frowned at ethically and severely punished in the court of law.

Explanation:

When setting prices, it is a standard practice to consider all factors that could result in business problems and legal battles.  It is not only economic profit consideration that should be taken care of, but there are competitive, socio-legal, and growth factors to be considered.  Ethics is also another important consideration.  Unethical violations could lead to fraudulent and illegal prosecutions.

You can buy an item for $140 on an in-store payment plan with the promise to pay $140 in 90 days. Suppose you can buy an identical item for $128 cash. If you buy the item for $140, you are in effect paying $12 for the use of $128 for three months. What is the effective annual rate of interest

Answers

Answer:

the effective annual rate of interest is 37.50%

Explanation:

The computation of the effective annual rate of interest is as follows:

Interest = Principal × rate × time period

$12 = $128 × rate × 3 months ÷ 12 months  

$48 = $128 × rate

rate = 37.50%

Hence, the effective annual rate of interest is 37.50%

We simply applied the above formula so that the correct annual rate could come

g each collectible ship requires one pint of high-quality paint at a cost of $25 per pint. considering increasing the selling prices of both models by 7.5%, which will cause volume of sales for both models to decrease by 12%. all other expenses would remain constant. should management implement this change and what is the best explanation

Answers

Answer:

Increasing the sales price is a bad idea since total revenues will decrease.

Explanation:

The question is incomplete since we are not given the information about other costs, but we are given enough information to calculate the price elasticity of demand:

PED = % change in quantity demanded / % change in price = -12% / 7.5% = -1.6 or |1.6| in absolute terms.

Since the PED is |1.6|, it is price elastic. This means that a change in price will result in a proportionally larger change in quantity demanded. E.g. assume original price is $100 and the original quantity demanded is 100. Total revenue = $10,000. If the price increases to $107.50, the quantity demanded will decrease to 88, resulting in a total revenue of $9,460.

an annual bond selld for $865 with par value $1,000 and coupoin rate 8% what is bond yeild to maturity for 10 years

Answers

Answer:

1.4484 %

Explanation:

The formula for Yield to Maturity =

[C + (FP - MP) /n]/FP + MP/2

Where

C = Coupon rate = 8% = 0.08

MP = Market value or price = $865

FP = Face or Par value = $1000

n = number of years = 10

Yield to Maturity =[ 0.08 +(1000 - 865) /10]/ 1000 + 865/2

Yield to Maturity = 1.4484 %

Parcel Corporation expects to pay a dividend of $5 per share next year, and the dividend payout ratio is 50 percent. If dividends are expected to grow at a constant rate of 8 percent forever, and the required rate of return on the stock is 13 percent, calculate the present value of growth opportunities.

Answers

Answer:

The present value of growth opportunities is $23.08

Explanation:

First, we need to calculate the price with growth

Stock Price = Expected Dividend / ( Required rate of return - growth rate )

Where

Expected Dividend  = $5

Required rate of return = 13%

Growth rate = 8%

Pacing values in the formula

Stock Price = $5 / ( 13% - 8% )

Stock Price = $100

Now determine the expected EPS

EPS = Dividend / Payout ratio

Where

Dividend = $5

Payout ratio = 50%

Placing values in the formula

EPS = $5 / 50%

EPS = $10

Now calculate the present value of growth opportunity

PV of Growth opportunity = Price with growth - ( EPS / Required rate of return )

Where

Price with growth = $100

EPS = $10

Required rate of return = 13%

Placing value in the formula

PV of Growth opportunity = $100 - ( $10 / 13% )

PV of Growth opportunity = $100 - $76.92

PV of Growth opportunity = $23.08

The net decrease in Prepaid Expenses (Prepaid) amounts to $30,000 and the net decrease in Accounts Payable (AP) is $20,000. Assuming no inventory provision involved, what is the net effect of Inv and AP on the adjustments to Net Income if the indirect method is used in the Statement of Cash Flows

Answers

Answer:

Net decrease in prepaid expenses of $30,000 will be added to the net income in adjustments to net income because it will be considered that working capital (inventory or any other expense) has been generated by the operations.

Net decrease in Accounts payable of $20,000 will be deducted from net income in adjustments to net income because decrease in accounts payable means that cash has been paid to the outstanding payables.

Net effect of the above transactions is $30,000 - $20,000 = $10,000

So, net income will be increased by $10,000 as net effect of the above adjustments.

Suppose a stock has an initial price of $71 per share, paid a dividend of $1.75 per share during the year, and had an ending share price of $88. Compute the percentage total return.

Answers

Answer:

Total return = 26.4%

Explanation:

Given:

Initial price = $71 per share

Dividend = $1.75 per share

Ending share price = $88

Compute:

Percentage total return

Computation:

Total return = [Ending share price + Dividend - Initial price)/Initial price

Total return = (88 + 1.75 - 71) / 71

Total return = 26.4%

In a market economy resources tend to be allocated optimally. Discuss how the interaction of consumers and producers makes this happen.

Answers

Answer:

Under the capitalist structure, the distribution of services is highly reliant mostly on price fluctuations of the commodities itself. For both buyers as well as vendors in the industry, price serves as a predictor.

Sellers can use heavy priced  limited raw commodities (e.g. the copper industry) or tools to manufacture high-value items to be specifically given specific pricing details. Similarly, only those buyers who see profit in buying those better priced goods would also enable them to maintain equilibrium within the scheme.

Why have nonalcoholic drinks increased in popularity, and what difficulties do bar managers face when serving alcohol

Answers

Answer:

People consumes less of alcohol and more of non alcoholic drinks.

Explanation:

Now-a days people consumes less of alcoholic drinks as non alcoholic beverages or drinks are becoming non popular day by day. People have become more health conscience and wants to remain fit. Now wonder alcohol causes a lot harm to the human health. People now are aware of the side effects of consuming alcohol.

In the recent years the life style of the people have change a lot and they they have become health conscious than before. The consumption of other non alcoholic drinks have become familiar and famous including green tea, fruit juices, goji juice and many more.

The bar managers also face difficulty in serving alcohol to people as people refuse to drink them. They are more health conscience and is aware of the fatal incidents about drunk driving. They prefer other non beverages in the bar. As a result the sale of alcohol has decreased a lot. There are also various awareness programs running against consumption of alcohol.Thus people do not drink alcohol any more and so it is difficult for the bar managers to offer alcohol to their customers.

Participative leadership is enhanced when:______

Answers

Answer:

employees partake in the decision making in an organization.

Explanation:

Participative leadership is enhanced when employees are involved in the decision making of an organization, hence creating a collaborative approach towards running and managing the organization.

In participative leadership approach, all the members within a team collaborate in terms of identifying essential goals and finding a means to achieving those goals. The importance of participative leadership is that it boost the morale of employees by giving them sense of belonging.

What criteria do accountants use to decide whether to use present or future values in accounting statements?

Answers

Answer:

Present value is nothing but how much future sum of money worth today. It is one of the important concepts in finance and it is a basis for stock pricing, bond pricing, financial modeling, banking, and insurance, etc. Present value provides us with an estimated amount to be spent today to have an investment worth a certain amount of money at a specific point in the future. Present value is also called a discounted value. It is an indicator for investors that whatever money he will receive today can earn a return in the future. With the help of present value, method investors calculate the present value of a firm’s expected cash flow to decide if a stock is worth to invest today or not.

The formula for calculating PV is shown below

PV = CF/ (1+r)n

Here ‘CF’ is future cash flow, ‘r’ is a discounted rate of return and ‘n’ is the number of periods or year.

Example

Let’s say that you have been promised by someone that he will give you 10,000.00 Rs 5 year from today and interest rate is 8% so no we want to know what the present value of 10,000.00 Rs which you will receive in future so,

PV = 10,000/ (1+0.08)5

PV = 6805.83 (To the nearest Decimal)

So present-day value of Rs 10,000.00 is Rs 6805.83

Explanation:

how will you prove that a piece of stone occupies space​

Answers

Explanation:

it is so weird, but try to understand

If Mariette does not want to track the quantity on hand of the products she sells, what Product/Service type should she select when setting up the items she sells in QuickBooks Online?

Answers

Answer: a. Non-inventory

Explanation:

QuickBooks online is an accounting software that helps millions of small and medium businesses.

If Mariette does not wish to track the quantity of the products she sells on hand, she should set these items up as Non-inventory items.

This designation is usually for goods that are immediately sold when purchased or were sold without even being purchased which means its for goods with really short shelf lives.

2019 balance sheet showed net fixed assets of $5.2 million, and the 2020 balance sheet showed net fixed assets of $5.8 million. The company’s 2020 income statement showed a depreciation expense of $335,000. What was the company's net capital spending for 2020?

Answers

Answer: $935,000

Explanation:

Net capital spending refers to the amount spent on acquiring new fixed assets.

= 2020 net fixed assets + 2020 depreciation - 2019 net fixed assets

= 5,800,000 + 335,000 - 5,200,000

= $935,000

Sources of economic growth would include an increase in:

a. Investment spending.
b. Financial investment.
c. Consumer spending.
d. Government spending.
e. Consumer saving

Answers

Answer:

Option e: Consumer saving

Explanation:

Consumer saving shows that the economy of a given country is growing. When a citizen of a country is employed, then unemployment decreases and consumers can be afford to buy some of their needs and still save some amount of money or valuables for future use. It shows that the economy growth is increasing in that country.

An increase in consumer savings can lead to more production, investment and others.

"Consider a C corporation. The corporation earns $2.5 per share before taxes. After the corporation has paid its corresponding taxes, it will distribute 50% of its earnings to its shareholders as a dividend. The corporate tax rate is 30%, the tax rate on dividend income is 20%, and the personal income tax rate is set at 28%. What are the shareholders earnings from the corporation after all corresponding taxes are paid

Answers

Answer:

$0.70 per stock

Explanation:

before tax corporate income = $2.50 per stock

after tax corporate income = $2.50 x (1 - 30%) = $1.75 per stock

distributed dividends = $1.75 x 50% = $0.875 per stock

since the tax rate on dividends is 20%, then the after tax gain earned by stockholders is $0.875 x (1 - 20%) = $0.70 per stock

Some dividends are taxed as long term capital gains (like these), which decreases the tax rate paid by stockholders. If they were taxed at the normal income rate, the tax rate would have been 8% higher.

Does the Statute of Frauds, a legal principle from the 1600s, still make sense in today's commercial world

Answers

Answer:

Yes.  The Statute of Frauds still makes sense in today's commercial world.

Explanation:

The statute of frauds as a legal concept requires that certain contracts must be put in writing, especially contracts involving the sale of land, goods worth more than $500, and contracts lasting more than one year.  The statute acts as a defense to a breach of contract claim. In most states, a statute of frauds does not make a contract void but makes certain contracts voidable. This means that the contract remains valid and enforceable until one of the parties chooses to void the contract.

The amount of interpersonal space (space between people while interacting) that is acceptable varies by culture. This activity is important because interpersonal space is one of the key cultural areas to understand in business if you want to bridge cross-cultural gaps. The goal of this exercise is to test your knowledge of the cultural area of interpersonal space.

Determine which of the following countries has Least Social Distance and Most Social Distance.

a. China
b. UK
c. Saudia Arabia
d. India
e. USA

Answers

Answer:

Note: The full question is attached as picture below

Below is in order, according to the amount of social distance (interpersonal space in a professional interaction) that would likely be expected during a business transaction in that particular country.

1 = Least Social Distance: 5 = Most Social Distance:

1 - USA

2 - UK

3 - INDIA

4 - CHINA

5-  SAUDI ARABIA

Randall owns and operates a successful landscaping company. His net profit income in 2019 was $209,000. What is the amount of SE tax he must pay

Answers

Answer:

Randall

The amount of SE tax he must pay is:

$22,540.60

Explanation:

a) Data and Calculations:

Net profit income for 2019 = $209,000

Self-employment tax:

First $132,900 * 15.3% = $20,333.70

Excess of $76,100 ($209 - 132,900) * 2.9% = $2,206.90

Total SE tax = $22,540.60

b) The IRS states that Randall's self-employment (SE) tax 2019 rate is 15.3 percent on the first $132,900 of his net profit income plus 2.9 percent on the net income in excess of $76,100 ($209 - 132,900).  It has been ascertained that being self-employed can significantly lower the tax bill. The self-employed can claim specific benefits, allowances, and reliefs if they are business expenses. These business expenses may include various office costs, advertising and marketing, and travel costs.

Explain what a cash budget is and why it is important for all businesses.


Answers

Answer:

A cash budget is very important, especially for smaller companies. It allows a company to establish the amount of credit that it can extend to customers without having problems with liquidity. A cash budget helps avoid a shortage of cash during periods in which a company encounters a high number of expenses.

Explanation:

Imagine that you are on the new business development team in your company. The team has been tasked with identifying a prospect list in a new sector. Which team decision-making approach will be best given the need for the team to be innovative in the generation of ideas

Answers

Explanation:

Analyzing the information, the most appropriate team decision-making approach is the Nominal Group Technique, which is a very appropriate group dynamics process when there is a need for the team to be innovative in generating ideas. Through this approach to team decision making, brainstorming can occur, which is the integration of all members in a dynamic process that seeks some common goal, as in the case of the question, which is to identify a list of potential customers in a new sector.

Through the technique of the nominal group, the team meets in order to discuss the problem to find a solution through innovative ideas and generation of ideas that can arise through the communication of the team. This is an approach that consists of a few steps that includes a final vote on the solutions found, which helps in the interactive and participatory process of all members of the group.

If you hope to be a college instructor in a subject, you need to plan to complete what level of education?
A.
Graduate school.
B.
Bachelor’s degree.
C.
Associate’s degree.
D.
Vocational school.

Answers

Hey if you hope to be a college instructor in a subject you need to plan to complete B. BACHELORS DEGREE
i hope it helps!
Other Questions
3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) At a sleepover, three friends ate of a pizza. For a snack the next day, the friends3 of the leftover pizza. What fraction of the pizza was not eaten?ate A Material Safety Data Sheet (MSDS) is a document that provides information about how to handle and safely dispose ofhazardous chemicals.sharps.infected body tissue.surgical equipment. Change the following sentence into passive form1. What question did they raise in the discussion?2. They are going to build that bridge in 20183. They used to build houses of wood 4. How many trees can we save for every ton of recycled newsprint ?5. We can make many things from wood 6. If I were you. I wouldnt accept his invitation 7. They must do it before I come 8. Where do they keep a large collection of books?9. They can find the books they want in the library 10. What do they keep a large collection of the books for ?Thank you very much What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... What are the outcomes of the ice cap melting? Choose all that apply.1. Light cannot be reflected back to the atmosphere2. Sea level rises3. Absorption of solar radiation leads to increase in ocean temperature4. Ocean remains unaffected paid rent of Rs.25000 by cheque. make journal entry m2 = by the .m1 = by the .m3 = by the . please help me with thisanswer choiceThis system has infinitely many solutions.This system has exactly one solution.This system has no solution.(5, 28) and (0, 0) please answer correctly no trolls! Gregory knows that Triangle A B C is reflected onto Triangle A prime B prime C prime. Which statement about the figures is true?If Gregory draws the segment with endpoints A and A, then the midpoint will lie on the line of reflection.If Gregory draws the segment with endpoints B and C, then the midpoint will be on the line of reflection.Points A and B are equidistant from the line of reflection.Line segment A B will be perpendicular to the line of reflection. Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? Rule-of-thumb budgeting is budgeting that's popular with the hospitality and tourism industry because it's so effective. trueorfalse can someone please answer these and explain how you did it2x - 7 = 117x + 1 = 223x - 8 = 228x +5 = 45 write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings?