What are two ways that society affects the progress of science?

Answers

Answer 1

Answer:

Technology usually affects society more directly than science because it solves practical problems and serves human needs (and may create new problems and needs). In contrast, science affects society mainly by stimulating and satisfying people's curiosity and occasionally by enlarging or challenging.

Explanation:


Related Questions

Only ------ percent of the food eaten is turned into its own body. *



20%

12%

10%

40%​

Answers

Answer:

12% I think this is right answer v

guy plz chat with me

Answer:

the answer is 10%

Explanation:

the 10% rule states that only 10% of energy is passed from one trophic level to the other (organism to organism)

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

When making bread why is the dough left in a warm place for a while before putting it in the oven

Answers

Answer:

so that bread will rise when heating

Explanation:

the yeast will activate and be ready to produce gases when baking

Which of the following is a distinct structure found specifically in the liver, spleen, and bone marrow?
Select one:
a. Sinusoidal capillaries
b. Fenestrated capillaries
c. Venous sinus
d. AV anastomoses
e. Continuous capillaries​

Answers

Answer:

option A is correct

Explanation:

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas de gestación; El Genotipo heterocigótico Gg produce lana gris y el genotipo homocigótico gg produce lana negra. Si se cruzan individuos heterocigóticos. Cuáles serán las proporciones fenotípicas esperadas en la progenie viva? *

Answers

Answer

1:2:1

Please  check the file,due to technical reasons there was issues  with submission

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

steps of Biological method of study taking malaria as an examples

Answers

Explanation:

The different steps which are involved in biological method are the the invasion, the rapid division followed by the spread of infection. ... Malaria results in infection after the bite of the female anopheles mosquito. The parasites enter the bloodstream. as a result of this there is predominant infection.

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful


1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

What is a pedigree? Please choose the correct answer from the following choices, and then select the submit answer button.
a) a tool to document harmful traits only
b) a type of family tree that can help answer questions about genes and their inheritance patterns
c) a cross between animals other than humans
d) a type of genetic test to determine probability of inheritance
e) a way of following genotypes that are the same as the phenotype

Answers

Answer:

b

Explanation:

A pedigree is a genetic representation of a family tree that diagrams the inheritance of a trait or disease though several generations

Answer:

B

Explanation:

Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on the X or Y chromosome. The resulting trait is influenced by multiple alleles. It is affected by alleles on at least three different chromosomes.

Answers

Answer:

the second one

Explanation:

there are only 2 sex linked chromosomes and that is X and Y

The true statement when describing sex-linked inheritance is ; ( B ) The alleles are found on the X and Y chromosome

The alleles responsible for reproductive inheritance from parents to offspring is contained in the X and Y chromosome of the reproductive gametes.

The female gametes contains double X chromosomes while the male reproductive gametes contains one X and one Y chromosomes. The alleles that are responsible for inheritance ( i.e. the sex of the offspring ) are contained in this chromosomes.

Hence we can conclude that The true statement when describing sex-linked inheritance is the alleles are found on the X and Y chromosome.

Learn more : https://brainly.com/question/24395447

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Which statements accurately describe the roles of water on earth

Answers

Answer:

C.

Explanation:

It carries cold water from the equator to the poles

Other Questions
ane is planning to offer a Groupon for inner tube rentals that she will distribute on hot, sunny, summer days by the river that runs through her town. Based on her past experience with Groupon, she has assigned the following probability distribution to the number of tubes she will rent on a randomly selected day. If Jane would like her expected revenue to be at least $300 per day, what should the Groupon price be? (Round your answer up to the nearest whole dollar amount.) Your textbook discussed a model of a simple economy with four markets: labor, capital, energy, and food. Which of the following statements is inconsistent with a general equilibrium for this simple economy?A. The household demand for energy equals the industry supply of energy. B. The household demand for food equals the industry supply of food. C. The household demand for labor equals the industry supply of labor. D. The household supply of capital equals the industry demand for capital. As the workforce becomes more diverse, why does performance appraisal become a more difficult process? PLEASE ITS VERY URGENTIf you can speak french please reply to this, I have a question How can a nation's government invest in human capital?by providing affordable medical careby building roads and bridgesby making education freeby reducing taxes on domestic tradeby facilitating vocational training(It could be multiple answers or just one) A company's gross profit (or gross margin) was $129,650 and its net sales were $502,900. Its gross margin ratio is How would I solve this? (y-z) z y=-2 and z=4/5 Charles Cooley developed the idea that you learn about yourself from the feedback you receive from others who react to you. So if others tell you that you are funny, you believe you are funny. This construct is called: if the morning temperature started at -7 celsius but warmed during the day to 24 celsius . What is the temperature change [tex]\frac{63,75660}{705,280}[/tex] you walk 6 block east, 2 blocks north, 3 blocks west and then 2 blocks north. the total distance you travel is blocks a shop has a sale and reduces all the prices by 15k in naira.find the sale price of an article of an article marked at 750naira Speedy Runner makes running shoes and they have gathered the following data for the month of October: Data Cash on 10/1 Expected Cash Collections Direct Materials Cash Disbursements Direct Labor Cash Disbursements MOH Cash Disbursements Operating Expenses Cash Disbursements Capital Expenditures Cash Disbursements Speedy Runner requires an ending cash balance of at least $12,000 and can borrow from a line of credit in $1,000 increments. How much will Speedy Runner need to borrow at the end of October? The graph of f(x) = 2x + 1 is shown below. Explain how to find the average rate of change between x = 0 and x = 3. Arrange the following substances in the order of increasing entropy at 25C. HF(g), NaF(s), SiF 4(g), SiH 4(g), Al(s) lowest highest Which table represents a linear function?x y1 52 103 15 4 205 25x y 1 5 2 20 3 454 805 125x y1 52 253 1254 6255 3125x y1 22 43 74 165 32 In what ways do you think the idea of banning slavery felt threatening to many in the South? cris ces phrases au pass compos. [ ] 1.Vous (pl. m.) sortez tous les jeudis 2. Nous mangeons du poisson. 3. Simon donne le T-shirt Rene. 4. Luc joue du piano. 5. Je tlphone Luc. 6. Les jeunes voient un film au cinma. 7. Je vais lcole. 8. Luc part 22 heures. cris les verbes manquants. [ ] 9. La famille ______ mang au restaurant. 10. Luc ______ all dans la cathdrale. 11. Je _____ parti tt le matin. 12. Vous ______ sorti de bonne heure. 13. Elles ______ revenues hier soir. 14. Tu _______ vu le film hier. Solve for x (x+4)/3 = 2.a. x = -2b. x=2c. x = 2/3d. x= -10/3 Which describes a consequence of steroid abuse? A. Javier notices his sense of balance is impaired. B. Penny develops severe headaches twice a week. C. John, "Mr. Calm," starts getting into fights at school.