What can farmers use to prevent the harming of beneficial insects?
a.
spray insecticides
c.
new pesticides
b.
natural pest control
d.
non-aerosol insecticides

Answers

Answer 1

Answer:

Natural pest control

Explanation:

Because its a way to be eco friendly using natural sources which does not harm insects

Answer 2
i think the answer is a or b

Related Questions


Edit: Nevermind! I figured it out!!

Use the information in the table to calculate the ages of the meteorites. The half-life of potassium-40 is 1.3 billion years.

Meteorite Initial Amount(g) Final Amount(g)

1 30 7.5

2 80 5

3 100 12.5


Use your calculations to answer the questions.


How old is meteorite 1?


How old is meteorite 2?


How old is meteorite 3?

Answers

Answer:

meteorite 1- 2.6 billion

meteorite 2- 5.2 billion

meteorite 3- 3.9 billion

Answer:

meteorite 1- 2.6 billion

meteorite 2- 5.2 billion

meteorite 3- 3.9 billion

Explanation:

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

When the total lunar eclipse occurs what are the relative positions of the sun earth and moon

Answers

Answer:

A lunar eclipse occurs when the Moon passes directly behind the Earth into its umbra (shadow). This can occur only when the sun, Earth and moon are aligned (in "syzygy") exactly, or very closely so, with the Earth in the middle.

Explanation:

Answer:

The earth is between the sun and the moon

Explanation:

The Moon is non luminous that is doesn't generate light by itself so it depends on light from the sun so when its path through which it taps light from the sun is totally covered it means the Earth is closer to the moon than the Sun so that the Earth gets all off its light leaving nothing for the Moon and in this case the Moon is thrown to total darkness.

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?

Answers

Answer:

immunosuppressant

Explanation:

After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.

All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

In ancient times, why would a cloudy day make it so hard to tell what time it is?

Answers

Answer:

Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time

What is a “shared derived character”?

Answers

Answer:

A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals. 

Answer:

A shared character is one that two lineages have in common, and a derived character is one that evolved in the lineage leading up to a clade and that sets members of that clade apart from other individuals. Shared derived characters can be used to group organisms into clades. For example, amphibians, turtles, lizards, snakes, crocodiles, birds and mammals all have, or historically had, four limbs. If you look at a modern snake you might not see obvious limbs, but fossils show that ancient snakes did have limbs, and some modern snakes actually do retain rudimentary limbs. Four limbs is a shared derived character inherited from a common ancestor that helps set apart this particular clade of vertebrates.

Glaciers pushing rocks against rocks is an example of

Answers

Answer:

Erosion??

Explanation:

Answer:

Glacial Erosion

Explanation:

What is the role of DNA in an organism ? how is dna related to reproduction​

Answers

Answer:

DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce. 

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

. Why is the carpel considered female and the stamen male?​

Answers

Answer:  A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.

Explanation:

Please help out! It would be very nice !!

Answers

Answer:D

Explanation:

Cell wall provides structure and protection

Answer:

D is the answer to the question

Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball

Answers

Answer:

Kicking a soccer ball

Explanation:

Answer:

Kicking a soccer ball

Explanation:because moving blood and having a heartbeat arent in need of a skeletal system

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

Which sex cell is produced in males?

Answers

Answer:

Sperm

Explanation:

Answer:

Sperm

Explanation:

What are the differences between parents and offsprings ?

Answers

Answer:

Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.

Answer:

Parents have offspring

Explanation:

Offspring is the result of sexual or asexual reproduction by parents.

What is the best definition of a chromosome? Based on the picture provided above :)

Answers

Answer:

d.

Explanation:

A chromosome is a strand of DNA that is encoded with genes. In most cells, humans have 22 pairs of these chromosomes plus the two sex chromosomes (XX in females and XY in males) for a total of 46. The word chromosome was originally coined in German from the Greek words khroma, meaning color, and soma meaning body.

explain how gas is compressed into liquid in a gas barrel

Answers

Explanation:

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. ... In liquids, the molecules are very near than that of gases.

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

what is the term for when the moon appears to be filling with light

Answers

Answer:

full moon

Explanation:

Which is the result of an object's motion?.

Answers

Answer:

Your answer would be if any of the object increases in mass. (A)

Explanation:

If we increase the mass of any object, the force of gravity would also increases.

hope it helps!

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

Why do we need human dna

Answers

DNA. Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things.

All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information.

We need human DNA since it give us the long term info storage, which is needed

DNA contains instructions for development, survival, and reproduction. DNA sequences must be translated into signals to make proteins, which do most of our body's job.

What is human genome?

DNA stores the instructions that are necessary for an organism to grow, maintain its existence, and reproduce itself. In order for these duties to be carried out, the sequences of DNA need to be transformed into messages that can be utilized in the production of proteins. Proteins are the complex molecules that are responsible for the majority of the work that is done in our bodies.

The human genome is comprised of all of the nucleic acid sequences that are found in humans. These sequences are stored as DNA within the 23 chromosome pairs that are found in the nucleus of cells, as well as in a tiny DNA molecule that is located within the mitochondria of each individual cell. In most cases, these are considered to be two distinct components: the nuclear genome and the mitochondrial genome.

Learn more about human genome, here:

https://brainly.com/question/25168976

#SPJ2

Describe natural selection

Answers

Answer:

Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.

Explanation:

best suited to the situation survive, and the ones that aren’t die

Which is the best evidence that two species have a common ancestor?

A:The two species have the same diet.



B:The two species live in the same habitat.



C:The two species' skeletal structures are 90% identical.



D:The two species' DNA sequences are 90% identical.

Answers

Answer:

I'd go with D.

Explanation:

Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.

The answer should be D

how did darwin’s theory of evolution change the way biologists thought about classification categories

Answers

Answer:

hhh3h3h3hgegegegegeggegsgsggs

y

Explanation:

hhhhhhshshshshhdhdhdhghdhgd

Because at the time they classify by if it fly,swims,run etc but after Darwin’s theory it was study that animals evolve depending on the area
Other Questions
find the center and radius of the circle x2+(y+8)2=4 Who is the government? What titles do these government officials have and what are their jobs? i will rate you brainliest PLZ HELPYou will get 25 points Jordan is tracking a recent online purchase. The shipping costs state that the item will be shipped in a 24-inch long box with a volume of 2,880 cubic inches. The width of the box is seven inches less than the height. The volume of a rectangular prism is found using the formula V = lwh, where l is the length, w is the width, and h is the height.Jordan is tracking a recent online purchase. The shipping costs state that the item will be shipped in a 24-inch long box with a volume of 2,880 cubic inches. The width of the box is seven inches less than the height. The volume of a rectangular prism is found using the formula V = lwh, where l is the length, w is the width, and h is the height. Which of the following are considered communication barriers Need help with these three pls!! Ill help you if you help me Christopher drove 199.5 miles in 3.5 hours. If he drove at a constant speed, how far did he drive in one hour? * A snack mix recipe calls for 2 1/2 cups of pretzels, 4 1/2 cups of dry cereal, 2 1/4 or peanuts, and 3/4 cups of raisins.If you want to make servings of 3/4 cup each, how many can you have with those ingredients? Anthony is a high school basketball player. How many points would Anthony score in a game if he made 8 three point shots and 2 two point shots ? How many points would Anthony score in a game if he made x three point shots and y two point shots? What year was the civil war Write a movie review to PS I still love you Which agent would cause the least damage to a chromosome? HELP U GUYS. For a fundraiser, Alex sold large boxes of oranges for $9 each and small boxes of oranges for $5 each. if he sold 17 boxes in all total for 105, how many more small boxes than large boxes did he sell? A.5B.7C.9D.11 CAN SOMEONE PLEASE HELP >.....< 30 POINTSSSSSSSSSSSSSHow important is it to know the atomic mass? explain what is a measure of an angle between the perpendicularbisectors of two adjacent sides of a regular polygon 3Sides ? What type of tree grew in Phoenicia and was considered very valuable?a)cedar b)elmc)maple d)oak Collete mapped her vegetable garden on the graph below. Each unit represents 1 foot.Collete plants an 8-foot row of lettuce in the garden. Which points could tell where the row oflettuce starts and ends?(-4,-1) and (-4,7)| (-1, 4) a (74)(-1,-6) and (8,-6)(-6, -1) and (-6,8) If you would like to improve communication, one of the first things you should try Which of these defines a volcano?A.An undersea rift that can cause the ocean floor to moveB.A mountain on Earth's crust through which molten material leaves the mantleC.A large pile of rocks and other debris that turn into liquid when heatedD.An extremely tall collection of liquid metals that harden when cooled