What do the arrows indicate?
Air moves in a direction that creates land breezes.
Air above land warms faster than air above water.
Air blows over long distances in a continual straight path.
Air pressure remains the same while cycling over land and water.
Answers
The best answer would be:
The first option.
Air moves in a direction that creates land breezes.
If you'd like to know more about this, you can read on:
The arrows show how air moves as land breezes are created. In coastal areas, land cools much faster than water, so what happens is the air above it gets cooled down. When this happens, it becomes more dense moves downwards towards land. This causes high pressure and cause winds to blow outwards towards water (ocean).
Air moves in a direction that creates land breezes. Therefore, option (A) is correct.
What is land breeze?A land breeze is a type of wind that occurs at night and flows from land towards the nearby body of water, such as a lake or ocean. It is the result of temperature differences between the land and water surfaces during the nighttime hours. Land breezes are typically observed in coastal regions or areas near large bodies of water.
During the day, the land surface heats up more quickly than the water surface. As a result, the air above the land becomes warmer and rises, creating a region of low pressure. Meanwhile, the water retains its temperature more effectively, leading to a cooler air mass above the water and a region of high pressure. This temperature contrast sets the stage for the development of a land breeze.
As the sun sets and the land cools down faster than the water, the pressure gradient reverses. The air over the land becomes cooler and denser, forming a high-pressure area. Simultaneously, the warmer air over the water creates a low-pressure area. The pressure difference drives the wind to flow from the land towards the water, resulting in a land breeze.
Land breezes are typically characterized by gentle and steady winds blowing from the land towards the water. They are often observed during clear and calm nights when the temperature contrast between the land and water surfaces is significant. Land breezes can have localized effects, such as influencing local weather patterns and affecting coastal ecosystems.
Learn more about land breeze, here:
https://brainly.com/question/29765563
#SPJ5
Related Questions
plant store _____ and other essential nutrients in the vacuole
Answers
Answer:
Plant store water and other essential nutrients in the vacuole.
Explanation:
Plant store water and other essential nutrients in the vacuole.
What is herbal medicine?
Herbal medicine is defined as the medicine which is acquired from the various parts of the plants such as flowers, roots, shoots, and leaves. Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
The main difference between herbal medicine and allopathic medicine is that the allopathic medicine is formed from the active or particular part of the plant but in herbal medicine whole plant parts are utilised.Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.
Therefore,Plant store water and other essential nutrients in the vacuole.
Learn more about plant here:
https://brainly.com/question/22167412
#SPJ2
11. When cold temperatures are produced in a chemical reaction, the reaction is
known as
a. exothermic.
b. endothermic.
c. suspension
Answers
Answer:
it's known as endothermic reaction
Explain the difference in How the tree and the fox get carbohydrates to use for energy
Answers
Hey Hey!
Hmm... This seems to be a simple questions. Plants/trees actually make their own carbohydrates through photosynthesis. A fox simply eats food and that is their carbohydrate source. Please mark brianliest<3!
How does the skin regulate body temperature?
Group of answer choices
by increasing sweat production
by producing vitamin D
by retaining water
by regulating fat content in the epidermis
Answers
How does the skin regulate body temperature?
[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Answer.}}}}}∘[/tex]
A. by increasing sweat production. ✔
Explanation:-
The sweat glands present in the skin helps to cool the skin as it produces sweat.Sweat glands keeps the body temperature at approximately 37° C by releasing sweat in a hot environment or during physical exertion.[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]
which of these animals did NOT benefit from the reintroduction of wolves into Yellowstone?
a. rabbits
2. bears
3. elk
4. beavers
Answers
Blood type A person marries a blood type B person, both are heterozygous for the trait, what could their offspring be?
AB
B
A
O
all of the above
Answers
Answer:
All of the above
Explanation:
DNA is a
A. lipid
B. nucleic acid
C. carbohydrate
D. protein
Answers
Answer:
B
Explanation:
Answer:
B. nucleic acid
Explanation:
DNA is a type of Nucleic acid.
what happens to the energy that is not converted to usable energy in a muscle Cell?
Answers
Answer:
The process is called oxidative phosphorylation and it happens inside mitochondria. In the matrix of mitochondria the reactions known as the citric acid or Krebs cycle produce a chemical called NADH. NADH is then used by enzymes embedded in the mitochondrial inner membrane to generate adenosine triphosphate (ATP).
Explanation:
Which molecule do mammals use to store extra glucose?
O starch
O cellulose
O myosin
O glycogen
Answers
Because glycogen is an large storage molecule of extra glucose
The Montreal Protocol of 1987 provided a global framework to phase out chlorofluorocarbon (CFC) production and use. A though the Montreal Protocol has led to a dramatic decrease in CFCs released into the atmosphere, stratospheric ozone destruction has decreased only slightly.
Answers
Answer:
True
Explanation:
there is a decreased in the production of
Answers
Answer:
Espero sirva mi respuesta
Explanation:
Suerte
Why do animals that are active at night tend to have trouble seeing in color?
Answers
The
store(s) more carbon than the atmosphere.
trees
soil
Oceans
rock
Answers
The oceans store more carbon than the atmosphere. Thus, the correct option is C.
What is Atmosphere?An atmosphere may be defined as an area that is surrounded by layers of gases across a planet or other celestial body.
The oceans are a gigantic carbon sink, and the domain of the positive authorization of the greenhouse gas cycle is that, as the oceans become warmer, they tend to discharge more carbon dioxide disbanded in the water.
Therefore, the correct option for this question is C.
To learn more about Oceans, refer to the link:
https://brainly.com/question/25154137
#SPJ1
what scientific term is used to describe all the genes of one organism?
Answers
Answer:
The scientific term used to describe all of the genes in an organsim is the genome.
Genome term is used to describe all the genes of one organism, it forms the genotype of an organism.
What is a genome?the entirety of an organism's genetic makeup, or DNA. Nearly every cell in a person's body has a complete copy of its genome. Everything a person needs to grow and develop is encoded in their genome.
Each and every one of the body's cells, such as the skin cell or the liver cell, carries the following set of instructions: DNA makes up the instructions in our genome.
The genome's main job is to preserve, express, and store the genetic material that gives rise to a cell's structural and functional machinery. The genome is a significant part of the cell's structural makeup, nevertheless. Hence, the Genome term is used to describe all the genes of one organism.
Learn more about the genome, here:
https://brainly.com/question/29362762
#SPJ6
what is the mosquito average life's span
Answers
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answers
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
What is the microscopic nature of a cell ?
Why nucleus is said to be the controller of cellular activities ?
How is a cell adapted to its small size?
Answers
Answer:
No 1 answer They require sophiscated tools. The microscopes help in the study of cells. The molecular study of the cells are performed by the help of electron microscope. So, we can say that cells are microscopic in nature.
Explanation:
No 2 answer The nucleus is the largest and most prominent of a cell's organelles (Figure 3.7). The nucleus is generally considered the control center of the cell because it stores all of the genetic instructions for manufacturing proteins.
No 3 answer Smaller single-celled organisms have a high surface area to volume ratio, which allows them to rely on oxygen and material diffusing into the cell (and wastes diffusing out) in order to survive. The higher the surface area to volume ratio they have, the more effective this process can be.
Which of the following shows the stage of mitosis in the correct order?
Answers
hope this helps! please mark me as brainliest :)
Prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis is the correct order of mitosis. Therefore, option (B) is correct.
Mitosis is a cellular process that ensures the accurate division of a cell's genetic material into two identical daughter cells. It consists of several distinct phases that occur in a specific order.
Interphase: The cell prepares for division by growing, duplicating its DNA, and synthesizing necessary proteins.
Prophase: Chromatin condenses into visible chromosomes, the nuclear membrane disintegrates, and spindle fibers form.
Metaphase: Chromosomes align at the center of the cell, known as the metaphase plate, and attach to spindle fibers at their centromeres.
Anaphase: Sister chromatids separate and are pulled to opposite ends of the cell by the spindle fibers.
Telophase: Chromosomes reach the opposite poles of the cell, and new nuclear membranes form around them. The chromosomes begin to decondense.
Cytokinesis: The cytoplasm divides, leading to the formation of two distinct daughter cells, each containing a complete set of chromosomes.
Learn more about mitosis, here:
https://brainly.com/question/31626745
#SPJ2
How does the behaviour of other mammals change when they are ready to mate.
Answers
Answer:
.........
Explanation:
They get possessive of their mates
They get restless
and in the case of humans they start getting cheesy and flirting
for other references...if you have Wattpad read the princes soulmate and the princes fiancee....to know more
(a) Describe why DNA replication is said to be a semiconservative process. Explain how random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism.
Answers
Explanation:
yan po sana makatulong po
sainyo
What are three benefits of vertical farming that provide an advantage over horizontal farming.
Answers
Answer:
Minimise water usage
Weather doesn't affect the crops
There is less exposure to chemicals and disease
Explanation:
Why do many water animals not have a well developed blood system?
Answers
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. Instead, gases, nutrients, and wastes are exchanged by diffusion.
Answer:
Explanation:
The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. ... Instead, gases, nutrients, and wastes are exchanged by diffusion.
Anyone know the answer?
Answers
3.gender:male
disorder name:non-disjunction(when the chromosomes fail to seperate or having extra number of chromosomes)
4.gender:female
disorder:down syndrome
A student lifted weights after
from school and felt his muscles
they began to burn. He couldn't continue
lifting weights after doing
exercise for a long time. Is
muscle fatigue is most likely
due to:
(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles
(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles
Answers
Answer:
lack of oxygen and accumulation of waste in the muscle
Small changes can add up over MULTIPLE GENERATIONS to make
A. the same species
B. new species
Answers
Answer:
b: new species
Explanation:
These changes are genetic mutations to their biological "code" meaning creating a new species would be possible.
Answer:
B. new species
Explanation:
Biological evolution is any change in the heritable traits within a population across generations.
what are the four primary uses or benefits of the nguni breed amongst South African communities?
Answers
Answer:
Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.
Explanation:
The ________ is the internal hereditary code that tells which _________ will be expressed.
Answers
Answer:
The genotype is the internal hereditary code that tells which phenotype will be expressed.
We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True
B. False
Answers
variation of reproduction produces diverse life forms and allows organisms to evolve complex characteristics over billions of years.
Answer:
A. True
Explanation:
Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
if the mass extinction event that had wiped out the dinosaurs had not occurred, could dinosaurs rather than mammals have evolved into an intelligent organism resembling modern day humans ?
Answers
Answer:
If the mass extinction even that had wiped out the dinosaurs had not occurred, dinosaurs would've evolved. Though maybe not into organisms that resemble modern-day humans, they would've become better versions of themself. However, some of them might've died out naturally due to climate change and other natural disasters.
If the mass extinction event had wiped out the dinosaurs and not occurred. The dinosaurs would not have been converted into an intelligent organism like humans, because evolution may be bad or good, nothing is always evolution that results in good traits.
What are dinosaurs?Dinosaurs are extinct reptiles, that were very big, and they were both herbivorous and carnivorous. These animals were present 56 million years ago. They got extinct because of an unknown reason, but scientists say that they got extinct due to the falling of meteorites.
If dinosaurs had not been extinct, they would be evolved according to the changes in the environment. They would not be converted into human intelligence.
Therefore, since evolution can be either positive or negative, there is no guarantee that it will always produce positive features in organisms, the dinosaurs would not have evolved into sophisticated beings like humans.
To learn more about dinosaurs, refer to the link:
https://brainly.com/question/15973044
#SPJ5
3) In order for an ecosystem to thrive, it needs to exist in a form of harmony and balance between its biotic and abiotic factors. Describe how small changes to both biotic and abiotic components can have major effects on an ecosystem.
Answers
Answer:
Changing temperature causes extinction or removal of organism from that place.
Explanation:
Small changes to both biotic and abiotic components can have major effects on an ecosystem because these are the factors on which the ecosystem depends. For example, if the temperature of the ecosystem increases from its limit, it makes the environment unfavourable for the organism so due to this change, the organism migrated to other location otherwise they will die due to unfavourable environment.
