Answer:
a. the number of rabits and mice increased
Explanation:
Hope it helps
Answer:
I believe the answer is a
Which is the result of an object's motion?.
Answer:
Your answer would be if any of the object increases in mass. (A)
Explanation:
If we increase the mass of any object, the force of gravity would also increases.
hope it helps!
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
You are a geneticist and two very angry hobbits, Pippin and Lola, come storming into your office. Pippin and Lola have just had a newborn baby girl named Beatrice. Beatrice has blue eyes, but pippin and Lola both have green eyes. Green eyes are dominant over blue eyes. Pippin thinks that Beatrice is not his baby, and is very angry with lola. Determine how it is in fact possible for Beatrice to be pippins baby girl.
A) What are pippin and Lola's genotype?
B) What is Beatrice's genotype?
Answer:
A.) If "G" is the dominant green-eyed gene and "g" is the blue-eyed gene, then Pippin and Lola's genotypes will both be Gg.
B.) Beatrice's genotype is gg.
Explanation:
I put this answer in the other question, but this just popped up as well so here you go :)
Answer:
a:Gg
b:gg
Explanation:
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
i really need help on this one, A,B or C.
Answer:
B
Explanation:
B makes the most sense of your answer choices
Answer:
A)
Explanation:
This is because the law of the conservation of energy states that energy can not be created or destroyed. This means that you can not get more energy than you put in, this could be from any energy store. In addition That also means that you will not be able to get less energy than you put in.
Although energy can not be created or destroyed some energy is lost to heat or friction, this would mean that the energy is not transferred to the idea store and so is lost to inefficiency . An example of this would be wind turbines, the wind would move the turbine using kinetic energy however some of the energy is lost to heat and friction
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Drag each description to the correct type of succession.
vacant parking lot for many years
Primary succession
Secondary succession
abandoned baseball field
recently cooled lava field
rocky hill under a melted glacier
clear-cut forest
1) Intro
Done
ivity
Answer:
1) vacant parking lot for many years (secondary succession)
2) abandoned baseball field (secondary succession)
3) recently cooled lava field (primary succession)
4) rocky hill under a melted glacier (primary succession)
5) clear-cut forest (secondary succession)
Explanation:
Succession in ecology is the gradual encroachment of life on a given ecosystem.
Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.
Answer:
PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.
Explanation:
it's correct
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?
Answer:
immunosuppressant
Explanation:
After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.
All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.
The image shows groundwater zones.
Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.
Which is the saturated zone?
1
2
3
4
Answer:
The answer is 3
Explanation:
Hope this helps
Answer:3 or c
Explanation:
In a certain state, electricity is generated by using the earths heat. Wells drilled and natural steam is taken out through pipes. This natural steam powers the generator and the electricity generated. What type of energy is being used and what type of power plants are set up for harnessing this renewable energy?
Answer:
Geothermal
Explanation:
The geothermal energy is generated by the Earth's core that is a region with extremely high temperatures. The heat makes the geothermal power plants to work and thus generate energy from it.
how did darwin’s theory of evolution change the way biologists thought about classification categories
Answer:
hhh3h3h3hgegegegegeggegsgsggs
y
Explanation:
hhhhhhshshshshhdhdhdhghdhgd
PLS HELP ME!!!!!!!!!!!
Answer:
From the mouse
Explanation:
It is directly gaining energy from the mous because the mouse is what gives the snake energy and if the snake directly consume it, it will get energy from it.
El aparato respiratorio presenta unas células productoras de ... Que atrapan los gérmenes y el polvo. En su superficie tienen una gran cantidad de unas estructuras celulares llamadas ... Cuya función es extender el mucus y dirigirlo hacia el exterior. En el estómago, las glándulas digestivas producen el ... El cual, por su extremada ... Ataca y destruye a los ... Que se introducen con la comida y la bebida.
Answer:
The respiratory system has cells that produce MOCO OR MUCUS, which trap germs and dust. On their surface they have a large number of cellular structures called CILIAS, whose function is to spread mucus and direct it outwards. In the stomach, the digestive glands produce the STOMACH ACID, which, due to its extreme ACIDITY, attacks and destroys the PATHOGEN MICROORGANISMS that are introduced with food and drink.
Explanation:
In the respiratory and digestive apparatus there are two types of super specialized mucous upholstery, where the cellular world is challenged.
In the respiratory mucosa the production of mucus and the mobilization of the cilia are part of the innate response of the organism as well as the acidity that is generated in the upholstery and in the gastric tract.
Describe natural selection
Answer:
Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.
Explanation:
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
Glaciers pushing rocks against rocks is an example of
Answer:
Erosion??
Explanation:
Answer:
Glacial Erosion
Explanation:
Which is the best evidence that two species have a common ancestor?
A:The two species have the same diet.
B:The two species live in the same habitat.
C:The two species' skeletal structures are 90% identical.
D:The two species' DNA sequences are 90% identical.
Answer:
I'd go with D.
Explanation:
Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
What is the best definition of a chromosome? Based on the picture provided above :)
Answer:
d.
Explanation:
A chromosome is a strand of DNA that is encoded with genes. In most cells, humans have 22 pairs of these chromosomes plus the two sex chromosomes (XX in females and XY in males) for a total of 46. The word chromosome was originally coined in German from the Greek words khroma, meaning color, and soma meaning body.
In ancient times, why would a cloudy day make it so hard to tell what time it is?
Answer:
Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time
I need helppp :( science ~
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
Describe three methods used to decrease the chances that microorganisms will spoil
the food.
1. wash your food.
2. put it in the fridge.
3. Cover it up.
I'm boredddd lol
Drying, refrigeration, and fermentation are methods used to decrease the chances that microorganisms will spoil the food.
Food preservation are techniques or practices which prevent the growth of microorganisms and slow the oxidation of fats in foods so as to prevent spoilage.
There are different methods of food preservation. Common methods which are used are drying, refrigeration, and fermentation.
Find out more at: https://brainly.com/question/18250110
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ
Answer:
A
Explanation:
Egg cell
The level of structural organization which best describes an egg is: A. a cell.
A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.
The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.
An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.
In conclusion, the level of structural organization in animals cells can best be describe by using an egg.
Read more: https://brainly.com/question/19559847
Biogeochemical cycles _______.
Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.
Explanation:
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
