Physics Middle School

What is a solution made of
answer choices A mixture and a solvent
b solute and a solvent
c solid and a gas

Answers

Answer 1

Answer:

b. solute and a solvent

Explanation:

Answer 2
B. The solute is the substance that dissolve and the solvent is the the substance that dissolve solute

Related Questions

Lunar eclipses happen when the _____.

moon passes between the Earth and the sun
Earth passes between the sun and the moon
sun passes between the Earth and the moon

Answers

Earth passes between the sun and the moon
Earth passes between the sun and the moon

Now you are creating a one-week plan for someone who is getting into shape. Include protein, carbohydrates, and good fats.

Help me create a week-long food plan for someone who is trying to get into shape.

Answers

Answer:

Explanation:

Day 1

Breakfast: scrambled eggs, stir-fried veggies, and oatmeal

Snack: whey protein shake

Lunch: grilled chicken breast, mixed greens, and baked sweet potato

Snack: hard-boiled egg(s) and carrot sticks

Dinner: broiled fish, green beans with brown rice

Day 2

Breakfast: protein pancakes with fresh berries

Snack: apple slices and almonds

Lunch: lean ground beef burger on lettuce with tomato, onion, and green beans

Snack: protein shake

Dinner: shrimp stir-fried with bell pepper and brown rice over spinach

Day 3

Breakfast: Greek yogurt, almonds or walnuts, whole grain granola, and fresh berries

Snack: protein shake

Lunch: grilled fish with a spinach salad and broccoli

Snack: egg white omelet with bell peppers and mushrooms

Dinner: chicken breast topped with fresh salsa with a sweet potato and a side salad

Day 4

Breakfast: oatmeal with berries and scrambled egg whites

Snack: turkey breast with carrots and celery

Lunch: sirloin steak with broccoli and mushrooms

Snack: apples with natural nut butter

Dinner: broiled fish, brown rice, and a mixed green salad

Day 5

Breakfast: protein shake with oatmeal

Snack: hard-boiled egg whites with sliced peppers and cucumbers

Lunch: grilled chicken with white bean and tomato salad

Snack: Greek yogurt with berries and nuts

Dinner: grilled fish with quinoa and green beans

Day 6

Breakfast: scrambled egg whites with cheese, peppers, herbs, and Ezekiel bread

Snack: protein shake

Lunch: grilled chicken breast with bell peppers, black beans, and onions over romaine lettuce

Snack: apple and almonds

Dinner: sirloin steak with sweet potato and asparagus

Day 7

Breakfast: Greek yogurt with whole grain granola and berries

Snack: turkey breast with carrots and celery sticks

Lunch: grilled chicken breast over spinach with sliced strawberries and almonds

Snack: protein shake

Dinner: shrimp stir-fried with peppers, onions, and broccoli over brown rice

Bye hope this helps!

sunday: 1 hour jog, 3 meals break fast lunch and diner each has a side of bread meat and veggies and water, and a snack between each meal.

monday: 2 hour jog, 3 meals break fast lunch and diner each has a side of bread meat and veggies and water, and a snack between each meal.

tuesday: 3 hour jog and a visit to the gym, 3 meals break fast lunch and diner each has a side of bread meat and veggies and water, and a snack between each meal.

wednesday: 4  hour jog and a visit to the gym, 3 meals break fast lunch and diner each has a side of bread meat and veggies and water, and a snack between each meal. play a sport.

thursday: 5 hour jog and a visit to the gym, 3 meals break fast lunch and diner each has a side of bread meat and veggies and Pomegranate Juice, and a snack between each meal. play a sport.

friday: 5 hour jog and a visit to the gym, 3 meals break fast lunch and diner each has a side of bread meat and veggies and Pomegranate Juice, and a snack between each meal. play a sport.

saturday: treat yourself

how fossil fuels are formed?? answer pls asap

Answers

After the remains of living organisms (plants and animals) were buried under the layers of the earth's crust, they were exposed to very high temperatures and pressures, which led to the concentration of carbon in it and thus turning it into fossil fuels used to produce fossil energy.

The composition of fossil fuels depends on the carbon cycle in nature, and is extracted from fossil materials such as coal, black petroleum coal, natural gas, and petroleum.

I hope it helped you^_^

They are formed by decomposed plankton

Explanation: it seems most reasonable
Other Questions
Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Very tired1) The professor (teach)five classes Monday. He (be)afterward2) You (feed)the birds that we saw yesterday. Some of them (be)cardinals.first on the trail Saturday, because he (know)the way3) Andy (go)better than we did.4) The house (be)dirty after they left. We (clean)it yesterdaythe motorcycles in the garage, then they (eat)5) The boys (put)lunch6) My friends and I (find)some gold in the river. Then we (look)formore.7) 1 (like)to write poetry when I (be)eight years old.8) Charlotte and I (see) lightening in the sky Thursday night; the storm (come)fast.9) The children (go)to the park yesterday. They (stay)for two hoursoutside after it (snow)Three inches of snow (fall)10) We (play)that dayI need to past simple tense?? does anyone know the quotient of x and y Dichotomous key (PLZ HELPLPP) Chrysanthenone is an unsaturated ketone. If Chrysanthenone has M+ = 150 and contains 2 double bond(s) and 2 ring(s); what is its molecular formula? Enter the formula in the form CH first, then all other atoms in alphabetical order; do not use subscripts. The formula is case-sensitive. someone help me pleaseeeeee Your company will generate $60,000 in annual revenue each year for the next seven years from a new information database. If the appropriate interest rate is 8.50 percent, what is the present value of the savings? (Do not round intermediate calculations and round your final answer to 2 decimal places, e.g., 32.16.)Present value Which of the following describes the end behavior of the function (x) = 5x3 + 3x2 + x 9?A) As x , y + and as x +, y B) As x , y and as x +, y +C) As x , y and as x +, y D) As x , y + and as x +, y + ASAP WILL MARK BRAINLIEST! NO LINKS PLEASE ,DUE IN 5 MIN! Using an order of magnitude analysis, estimate the total textbook expenditures incurred by all engineering majors at National University per year