Answer:
this is what I found online:
"Element Identification is a helpful skill to decide what action is needed…… (IE levels of research via sources and or investigation.) By taking each legal situation and breaking. From this point you may begin identifying the. legal issue of the complaint/case."
In Hamdan v. Rumsfeld , the U.S. Supreme Court held that detainees in Guantanamo:____.
a. deserved some due process and that the military commissions created at the time were not sufficient.
b. did not deserve some due process and that the military commissions created at the time were sufficient.
c. did not deserve some due process and the military commissions created at the time were not sufficient.
d. deserved some due process and that the military commissions created at the time were sufficient.
Answer:
c
Explanation:
Which of the following would most likely be considered a violation of the Fourth Amendment?
OA.
Confiscating the cellphone of a student who made a bomb threat
OB.
Searching the lockers of all students with black hair
O c. Stopping a vehicle believed to be involved in a bank robbery
OD
Stopping and searching all cars at the US-Mexico border
Answer:
OB
Explanation:
There is no reason to confiscate them but people in all other options could be doing something, have done, or they are currently doing it. Everything but OB is reasonable.
I need help please.
Answer:
the answer is true
Explanation:
because the force is greater than that which is needed to compel compliance
Which of the following is a belief held by the theory of natural law?
networks
Guided Reading Activity
Economic Systems
Lesson 1 Scarcity and the Science of Economics
Review Questions
Answer:
Explanation:
networks
Guided Reading Activity
Economic Systems
Lesson 1 Scarcity and the Science of Economics
Review Questions
19. To bring a derivative suit, a shareholder must own stock at the time of the
A. injury and at the time of the suit.
B. injury only
C. suit only
D. trial, suit, and injury
Answer:
A. injury and at the time of the suit.
Explanation:
A corporation can be defined as a corporate organization that has facilities and owns or controls assets used for the production of goods and services in at least one country other than its headquarter (home office) located in its home country.
This ultimately implies that, a corporation is a corporate organization that owns or controls its business in two or more countries.
One of the advantage of a corporation is that, owners have limited liability for debt to the extent to which they have invested and as such are not personally liable for some of the debt owed by corporation.
A derivative suit can be defined as a lawsuit that's brought forward by a shareholder on behalf of a corporation, to either defend or enforce a legal right (claim) against a third party such as a director or executive officer in the corporation.
Hence, to bring a derivative suit to a court of competent jurisdiction, a shareholder must own stock at the time of the injury and at the time of the suit.
An attempt by the seller to limit responsibility to the consumer in case anything goes wrong.
A - Disclaimer
B - Warranty
C - Defect
D - Contract
Answer:
D) A contract.. that the obvious because when you do business with anyone you would want to have a contract on deck because people play games and also so if things go wrong you have proof in court.
WHAT CRIMES ARE COMMITTED BY BOTH MEN AND WOMEN (give 5 crimes)
, murder, robbery, assault, kidnapping.
Answer:
1. Embezzlement
2. Domestic Violence
3. Murder
4. Car Theft
5. Extortion
Explanation:
What is the default join type?
Answer:
If this is for edge....it’s A) inner
Explanation:
examination of bill of entry is done to vouch
Answer:
What? I Don't understand
Explanation:
Bistro Caterers contracts with Corporate Towers to cater the firm’s business meetings. Later, the contract between Bistro and Corporate is completely rescinded. Even later, Bistro offers to make a new deal. Corporate is willing to deal, but for a new price. Bistro and Corporate
a. may agree to a new contract, but it cannot include a new price.
b. must perform the part of their original contract that is executory.
c. must perform their original contract.
d. may agree to a new contract that includes the new price.
Answer:
d. may agree to a new contract that includes the new price.
Explanation:
A contract can be defined as an agreement between two or more parties (group of people) which gives rise to a mutual legal obligation or enforceable by law.
There are different types of contract in business and these includes: fixed-price contract, cost-plus contract, bilateral contract, implies contract, unilateral contract, adhesion contract, unconscionable contract, option contract, express contract, etc.
Mutual assent is a legal term which represents an agreement by both parties to a contract. When two parties to a contract both have an understanding of the parameters, terms and conditions surrounding a contract, it ultimately implies that they are in agreement; this is generally referred to as mutual assent.
Since the original contract has been completely rescinded (declared void, repealed or annulled), Bistro and Corporate may agree to a new contract that includes the new price based on mutual assent between the two parties.
What can people do if they feel that a law is unfair?
Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
what is the relationship between law and morality with regard to euthanasia?
Answer:
please give me brainlist and follow
Explanation:
The law plays no role in euthanasia if good fortune or good medicine allows such a death. Today, however, euthanasia all too often attracts a second meaning1, an act or omission designed to hasten death and thus relieve the suffering of a dying or incurably sick patient.
juvenile means what?
Answer: A "juvenile" is a person who has not attained his eighteenth birthday, and "juvenile delinquency" is the violation of a law of the United States committed by a person prior to his eighteenth birthday which would have been a crime if committed by an adult.
please give brainlest if this helps!
The legalization of drugs is neither unwise nor immoral. It is not unwise because by legalizing drugs we would eliminate the illegal drug trade. Hence, by legalizing drugs, we would rid our nation of all the violence that goes along with the illegal drug trade. Furthermore, the legalization of drugs is not immoral because it can be combined with a massive program of moral education. The conclusion in a standard argument form is often presented as __________
Answer:
Inductive
Explanation:
Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!
Damian and Hunter are college roommates from very different walks of life. Damian was raised in a poverty-stricken city by a single mom. Hunter is the son of a small-town doctor and his socialite wife. Regardless, they get along well. Over time, they become known around campus as a good source for illegal drugs. For several years, Damian and Hunter run their business successfully. When the police finally catch up with them, they are both arrested. Following the theory of radical criminology, what is MOST likely going to happen to the two men?
A.
Damian will get an easier sentence because he did not have the advantages that Hunter did.
B.
Hunter will get a harder sentence because he had more privileges growing up.
C.
Both men will get equal sentences under the law.
D.
Damian will get a harder sentence because of his background.
Answer: D. Damian will get a harder sentence because of his background
Explanation:
Radical criminology bases its opinion on the fact that the state uses its power to make laws that will be beneficial to the ruling class while the working class are left out. It simply means that the laws made benefits the rich at the expense of the poor in the society.
Therefore, since Damian was raised in a poverty-stricken city by a single mom while Hunter is the son of a small-town doctor and his socialite wife, Damian will get a harder sentence because of his background.
Which of the following actions is illegal for selling alcohol
Answer:
no options
Explanation:
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
Which television show or movie shows procedures/or a process to collect evidence from a violent crime scene that differs from the actual procedures/process that happen in real life. Then discuss how these two procedures or processes regarding evidence collection portrays the criminal investigation process and how these processes or procedures differ from the actual reality of a crime scene investigation.
* I’m not really. Interested in crime shows so I don’t have a clue
Answer:
Criminal law
Explanation:
Answer:
Mindhunter
America's Most Wanted
Criminal: UK
Can you sue and win if someone is black mailing you over something illegal you did. If not is there any thing else you can do to take legal action and protect yourself.
A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.
Explain any 2 significance of public administration.
Public administrators play a crucial role in aiding federal agencies, such as the Department of Health and Human Services and the Transportation Security Administration.
On a local level, public administrators organize efforts to improve communications and share data between public safety services
How is the citizen important in American heroes
Answer: they ply there important roles as citizens
Explanation:
The course of action a government takes in response to an issue or problem is called
federalism.
A. Federalism
B. Bureaucracy
C. public policy.
d. interstate policy.
Keisha committed a crime in New York, but the punishment for the crime is harsher in Georgia, so the prosecutor organizes her case to be transferred to Georgia
Answer:
Keisha has the right to be tried in New York under the Sixth Amendment: “In all criminal prosecutions, the accused shall enjoy the right to a speedy and public trial, by an impartial jury of the State and district wherein the crime shall have been committed[.]”
Explanation:
Keisha committed a crime in New York, but the punishment for the crime is harsher in Georgia, so the prosecutor organizes her case to be transferred to Georgia because the sixth Amendment protects a criminal defendant the right to be represented by an attorney during trial.
What is crime?The term crime refers to the illegal activity. The crime is not allow to the country, if any person is commit the crime are go the jail. The legal punishable by the state in case of crime. The punishment is set according to the different crime. For example a person is harm another person property.
Keisha has the rights to be tried in New York underneath the Sixth Amendment, which states that "in all criminal proceedings, the accused shall have the right to a prompt and public trial, by an unbiased jury appointed by the state and jurisdiction wherein the crime may have been committed."
As a result, the conclusion of the sixth Amendment protects a criminal defendant the right to be represented by an attorney during trial are the aforementioned.
Learn more about on crime, here:
https://brainly.com/question/9997722
#SPJ2
Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35
Answer:
It is C.30 years old
Explanation:
There has been a high rate of bicycle accidents in your community. The local police department has decided to host free bicycle safety seminars at a local community center. The officers who conduct the trainings are being paid for the time they conduct these seminars.
Is this example a public policy?
Answer:
yes they are helping with the incidences of the bicycles
Explanation:
what is the example of red lie?
red lie are lies to harm others
Explanation:
example:
Danice: Mr William Jake took your phone and smashed it on the ground
Mr William: What?
* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*
Hope it helps
A claim made with full knowledge that the opposing person already knows it to be untrue.
What is a red lie?Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.
An example of a red lie will is:
Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a red lie that is presented.
Learn more about red lie, here:
https://brainly.com/question/25427223
#SPJ2
Plz answer questions 3-10 correctly, will give brainliest
