What is RNA primase's job?
-removing a few bases for DNA polymerase
-add a few bases for DNA polymerase
-removing a few bases for helicase

What Is RNA Primase's Job?-removing A Few Bases For DNA Polymerase-add A Few Bases For DNA Polymerase-removing

Answers

Answer 1

Answer:

The correct answer is - add a few bases for DNA polymerase

Explanation:

A short extended nucleic acid composed of ssRNA molecule. This is a molecule that synthesize a primer initialy and later again lay down a primer after the opening of replication fork by DNA helicase.

It sysntheisze before and after the helicase and follow the helicase in order to prepare for the replication process. Thus, adding a few bases for DNA polymerase is main job of RNA primase.


Related Questions

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules

The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there to
A)
move liquid.
B)
catch debris.
C)
secrete mucus.
D)
transmit impulses

Answers

Answer:

B. catch debris in the lungs

B. Catch debris would be the answer

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

What process increases genetic variation

A. Mitosis
B. Asexual Reproduction
C. Codominance
D. Crossing- Over

Answers

Answer:

Crossing Over

how did advancements in technology help scientists better understand process of cell division?

Answers

Answer:

As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.

Explanation:

Hoped I helped you out please mark me brainliest!!!

With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.

What is a microscope?

A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.

In most cases, the light is focused on the sample by passing it through a condenser.

After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.

The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.

Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.

For more details regarding microscope, visit:

https://brainly.com/question/18661784

#SPJ2

Bam hi cuts between what bases

Answers

bam hi cuts?
can you clarify what that is so i can help you?

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

Zara had a birthday and was able to choose a pet. The pet that she chose was a beautiful clownfish named Bozo, a common salt water fish. Zara already has a tank with goldfish at home. Use your knowledge of diffusion & osmosis to tell Zara how to take care of Bozo.

Answers

Answer:

See the answer below

Explanation:

The advice I would give  to Zara would be that she should keep Bozo in a separate tank with common salt water away from the goldfish. Bozo is a salt water fish while the goldfish can only survive in freshwater.

If Bozo is kept in a saltless water/freshwater tank with the goldfish, the water would be hypotonic to Bozo. Consequently, water will osmotically diffuse into the cells of Bozo, the cells would become turgid and lyse, and this would lead to the death of the fish.

If the goldfish is kept in the same salt water tank with Bozo, the salt water would be hypertonic to the goldfish. Consequently, water will osmotically diffuse out of the cells of the goldfish into the surrounding salt water, the cells of the goldfish would become flaccid, and this would lead to the death of the fish.


If a strand of
DNA reads ATC
C, what would
the other side
read?

Answers

Answer:

TAGG

Explanation:

Adenine always pairs with thymine and cytosine always pairs with guanine

1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?​

Answers

Answer: 1. The nitrogen cycle is a biogeochemical cycle.

2. The carbon cycle is a biogeochemical cycle.

Explanation:

1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.

2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

Whats the answer giving brainliest HELP!!!!!

Answers

Answer:

I feel like the first one is the best

Explanation:

widening the roads will just cause more cars.

raising the price is most likely not gonna help but its an option.

expanding just means more cars

Explain the difference between how light falls on the Earth near the Equator or the Poles

Answers

Answer:

Explanation:

The normal amount of solar radiation reduces from the Equator to the poles. This is because the low latitudes (near the Equator deliver relatively large amounts of radiation all year, and at high latitudes (near the poles), the more slanting angle of the Sun’s rays together with long periods of darkness in the winter, result in a low amount of received radiation.

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Summarize the roles of glucose and ATP in
energy processing.

Answers

Answer:

Summary. Glucose is the carbohydrate produced by photosynthesis. Energy-rich glucose is delivered through your blood to each of your cells. ATP is the usable form of energy for your cell

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

How does increasing plant biomass (amount of plants) affect atmospheric CO

Answers

Answer:

Since there are more plants more carbon dioxide is being removed because plants are carbon reservoirs.

Explanation:

In mitosis, parent cell(s) divide into daughter cell(s).

Answers

Answer: yes, mitosis is simple cell division

Explanation: mitosis is the process by which a cell divides into two cells, each with DNA from the duplication of the two original strands (in eukaryotes, duplication of all chromosomes).

Answer:

One, two

Explanation:

When ONE parent cell divides, it divides into TWO daughter cells.

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

What is seed dispersal? Name some agents of seed dispersal​

Answers

Answer:

The Process by which seeds spread over a wide area is known as seed dispersal..

some agents

Air

water

animals

etc..

Answer:

Seed dispersal is the movement, spread or transport of seeds away from the parent plant.

The most common methods are :

wind, water, animals, explosion and fire.

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

uses of crush in the farm​

Answers

Answer:

ok i dont understand what that is

Explanation:

Answer: The overall purpose of a crush is to hold an animal still to minimise the risk of injury to both the animal and the operator while work on the animal is performed.

please help with this question​

Answers

Answer:

a -5

d -2

c-3

b-4

e - 5

Explanation:

I'm guessing this is the answer

Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem


WILL GIVE BRAINLIEST

Answers

1 population
2 species
3 economists
4 biome
5 biosphere

Question 9 of 10
Which process is a form of mechanical weathering?

Answers

Explanation:

abrasion, pressure release, thermal expansion and contraction and crystal growth.

Describe the structure of the conjugated protein
haemoglobin, with reference to the levels of protein
structure.

Answers

Answer: Answer below, hope this helps! :D

Explanation:

A conjugated protein is a protein that functions in interaction with other (non-polypeptide) chemical groups attached by covalent bonding or weak interactions. ... The non-amino part of a conjugated protein is usually called its prosthetic group. Most prosthetic groups are formed from vitamins. Hemoglobin is a protein having a globular structure. Based on its structural properties, hemoglobin can be divided into two parts; a protein part and a heme group. The structure of the protein part can be studied at four levels; primary structure, secondary structure, tertiary structure, and quaternary structure.

I need someone to do a very big task for me in biology..I will give brainlist. The teask i need is the first one in my profile. Thankyou

Answers

Answer:

Explanation:

i'll try

4. How does temperature affect chemical weathering?
A. It is an agent of weathering.
B. It affects the amount of oxygen involved in weathering.
C. It affects the rate of weathering.
D. It affects the type of weathering.

Answers

Answer:

C.

Explanation:

It affects the rate of weathering.

Other Questions
What causes a conflict in the story? Button, Button Who studies ancient times and ancient peoples? math The newly elected president needs to decide the remaining 3 spots available in the cabinet he/she is appointing. If there are 15 eligible candidates for these positions (where rank matters), how many different ways can the members of the cabinet be appointed What are the social consequences of sustainable use of land? Is burning physical or chemical change? solve each inequality and graph the solution .2x-8 72 + (13- 4) + 5 x 2372 ++5x272 + 9 +5 %+ 5 X 88+ I need the equation that passes through the point Urgente necesito entregar la tarea a las 9:20!! Qu papel juegan las comillas, la coma y el punto y coma para la interpretacin del texto A net for a rectangular prism with dimensions of 1 centimeter, 2 centimeters, and 5 centimeters is given.What is the surface area of this rectangular prism?Enter your answer in the box. cmThe figure contains a net of a solid. The net is made up of 6 rectangles. The first rectangle has a length of 5 centimeters and a width of 2 centimeters. Each side of this rectangle shares a side with one other rectangle. The rectangles above it and below it each have a length of 5 centimeters and a width of 1 centimeter. The rectangles to its left and right each have a length of 1 centimeter and a width of 2 centimeters. The sixth rectangle shares its bottom side with the top side of the upper 5 centimeter by 1 centimeter rectangle. The length of the sixth rectangle is 5 centimeters, and its width is 2 centimeters. if h(x)=x power of 2 -5x+7 find the value of h(-5) Which of the following is equivalent to the image belowA: 6B: 8C: 12D: 64 BRAINLIEST How does Brian change as a character in the first half of the novel "Hatchet"? What lessons are vital to these changes, and how are they connected to the story's themes of survival and man vs. nature? Answer this question with at least two paragraphs of 5-7 sentences each. Include at least three pieces of textual evidence to support your answer. What is the quotient of 2/3 divided by 4 Which feature does an iron metal have?O electrons that transfer between atoms to make cations and anionsO a sea of electronsO firmly bonded electronsO electrons shared between single pairs of atoms MATH PLSS (I'LL TRY TO GIVE BRAINLIEST) state the duties faction and the responsibilities or the role of the three branches of the governmentplss pa help naman po dito Mr. Demers is making a drink by adding flavor drops to his water. If he puts 3 drops in a 12 ounce glass of water, how many ounces does he use PER DROP? Can anyone help solve this? Using the sentence context, determine the meaning of the word "copious" in the following example.Given that Arturo has read more than 23 books about volcanoes, his knowledge about the eruption of MountVesuvius is copious.abundantlimitedimpressive