What is the boundary between the earths lower mantle and the upper mantle called ?

Answers

Answer 1

Answer:

i have trusted my best to answer

Explanation:

Edit

The upper mantle of Earth is a very thick layer of rock inside the planet, which begins just beneath the crust (at about 10 km (6.2 mi) under the oceans and about 35 km (22 mi) under the continents) and ends at the top of the lower mantle at 670 km (420 mi). Temperatures range from approximately 200 °C (392 °F) at the upper boundary with the crust to approximately 900 °C (1,650 °F) at the boundary with the lower mantle. Upper mantle material which has come up onto the surface is made up of about 55% olivine, 35% pyroxene and 5 to 10% of calcium oxide and aluminum oxide minerals such as plagioclase, spinel, or garnet, depending upon depth.


Related Questions

ANSWER PLS 20 PTS THANKS

Answers

It only says 10 points not 20 lol

How are the early stages of embryonic development different from the later stages of development?

Answers

The early stages of embryonic development begin with fertilization. The process of fertilization is tightly controlled to ensure that only one sperm fuses with one egg. After fertilization, the zygote undergoes cleavage to form the blastula

6. In an ecosystem, sometimes more than one animal is a predator to the same animal. For example, the great barn owl and the the bald eagle both share a habitat, and they both hunt mice. Which answer explains how this relationship can work? a. They are both hunted by the red fox. b. The eagle migrates to other ecosystems. c. The owl hunts at night, and the eagle hunts during the day. d. There is an overpopulation of owls.​

Answers

Answer:

C. The owl hunts at night, and the eagle hunts during the day.

Explanation:

They both have an equal opportunity to get food just at different times.

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

What do the bullhorn acacia
trees get from the acacia
ants?

Answers

Answer:

The plants provide food and accommodation in the form of food bodies and nectar as well as hollow thorns which can be used as nests. The ants return this favor by protecting the plants against herbivores

Explanation:

PLZ HELP ASAP I NEED THIS NOW

Answers

Your lungs…………,……………..

Choose three things that blood transports throughout the body.

Nerve impulses

French fries

DNA

nutrients

wastes such as CO2

oxygen

Answers

Answer:

nutrientswastes such as CO2oxygen

Explanation:

Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.

The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).

1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.

2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.

3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.

Learn more about Blood, here:

https://brainly.com/question/32316698

#SPJ6

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

Blood is at it's highest pressure just when it leaves the heart. Why so?

Answers

Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.

Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

which structure is unique to eukaryotic cells

Answers

Answer:

Unlike prokaryotic cells, eukaryotic cells have a membrane-bound nucleus, a central cavity surrounded by a membrane that houses the cell's genetic material. A number of membrane-bound organelles, compartments with specialized functions that float in the cytosol.

Explanation:

hope this helps

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

Gizmos ( Building DNA )
Activity A :
Question : What is the structure of DNA
Build : follow the steps given in the gizmo to construct a molecule of dna

Answers

Answer:

Double Helical Spiral structure

Explanation:

DNA is a helical spiral structure in which two long strands of nucleotide form a double helix structure.

It looks like a structure of ladder in which the phosphate and sugar molecules from the side of the ladder and the base pairs form the rungs.

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

Photosynthesis in plants is an example of​

Answers

Answer: If you are asking if your answer is correct, it is. Photosynthesis is the process of converting sunlight into food and energy, therefore it is an example of nutrition.

Photosynthesis in plants is an example of nutrition

What is photosynthesis?

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar.

It is carried out by algae, plants and even some microorganisms.

The sugar produced form photosynthesis is a great source of nutrients for photosynthetic organisms and plants.

Therefore, photosynthesis in plants is an example of nutrition

Learn more about photosynthesis here:

https://brainly.com/question/3529377

#SPJ9

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?

Answers

i don’t know spanish sorry

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.​

Answers

Answer:

.

Explanation:

............................

The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

What is Canyon landscape?

A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.

Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.

Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

Learn more about Canyon landscape, here:

https://brainly.com/question/22035152

#SPJ2

Which of the following best contrasts the structures found in plant and animal cells?

A. Animal cells have a large vacuole, a cell wall, and chloroplasts while plant cells have small vacuoles, no chloroplasts, and no cell wall.
B. Animal cells have small vacuoles and no chloroplasts while plant cells have chloroplasts, a large vacuole, a cell wall.
C. Animal cells have small vacuoles, a cell wall, and no chloroplasts, while plant cells have a large vacuole, no cell wall and chloroplasts.
D. Animal cells have a large vacuole and no chloroplasts while plant cells have small vacuoles, chloroplasts, ands a cell wall.

Answers

Answer:

B

Explanation:

The answer is B because animals have small vacuoles and no chloroplast while plants cells have chloroplast, a large vacuole, a rigid cell wall.

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

What is the name of the green stuff in leaves?

Answers

Answer:

THE NAME OF THE GREEN STUFF IN LEAVES ARE Chlorophyll
the name is chlorophyll
Other Questions
The sky ride at an amusement park spans 2,715 feet. Over the course of the day,Anna rode the sky ride 7 times. How many feet did she ride? A. 14,025 feet B. 15,500 feet C. 19,005 feet D. 21,000 feetWhoever answers this then there gonna get Branliest Why was agricultural sector declared as critical industry and exempt from the hardest lockdown regulations compare a market in equilibrium with a market in disequilibrium PLEASE HELP ILL MARK BRAINLIEST!!!From which two international agreements do most nations derive their intellectual property laws?Digital Millennium Copyright Act (DMCA)Berne ConventionPreventing Real Online Threats to Economic Creativity and Theft of Intellectual Property Act (PROTECT IP or PIPA)World Intellectual Property Organization (WIPO) Copyright TreatyStop Online Piracy Act (SOPA) Caleb is working as pharmacy technician. He has decided that he wants to continue with his education because he wants to become a pharmacist. Which statement BEST describes Caleb's situation?a. Caleb has some education but needs to pass the certification exam.b. Caleb has a license and is wanting to obtain a certificate.c. Caleb has a certificate and is wanting to obtain a license.d. Caleb has passed one PTCE but still needs to pass the other. Which sequence is an example of an arithmetic sequence? A) 8, 4, 2, 1, . . . B) 4, 2, 0, 2, 4, . . . C) 1, 7, 49, 343, . . . D) 2, 4, 8, 16, 32, . . .i dont have the membership. Can someone help asap!!? Given a mass of 70 g and a volume of 25 mL, what is the density? Simon, a respected high school teacher, has a cousin who is infamous for his criminal activities. When Bob, a police officer, gets an alert about an absconding bank robber in the area where Simon lives, Bob raids Simon's house without a warrant. He conducts a thorough search of Simon's home for clues related to the robbery and the missing money, but he does not find anything against Simon. In this scenario, Bob has violated the _____ to the Constitution. Bharti Airtel is the largest cellular provider in India, with more than 300 million customers as of 2014. It also supplies broadband and telephone services, as well as many other telecommunications services to both domestic and corporate customers. Until a few years ago Airtel did not own its own towers, which was a particular strength of some of its competitors, such as Hutchison Essar. Towers are important if your company wishes to provide wide coverage nationally. In a SWOT analysis, this point would be ________. I am desperate please help. Help me fast 50 points!!!!!!!! Kelly is going two work two part-time jobs during the school year. When she works for her dad, she will make $8.00 per hour. When she works at a day care center, she will make $14.00 per hour. To pay her car payment, Kelly needs to make at least $84.00 a week and can work no more than 10 hours total per week. Write an inequality to represent the difference combinations of hours working for her dad,X, and hours working for the daycare center,Y, Kelly can work if she wants to earn at least $84 per week Is (x - 2) a factor of y = x3 + 2x2 - 9x - 18 ?A: YesB: NoC: Cannot be determined Before dating, a young person should consider their morals, _________, beliefs, what is healthy, what is safe, and right for them personally. Flagstaff Company has budgeted production units of 9,000 for July and 9,200 for August. The direct labor requirement per unit is 0.50 hours. Labor is paid at the rate of $22 per hour. The total cost of direct labor budgeted for the month of August is: find the coordinate for the mid point of the segment with the points given (-16,0)(0,-16)(-8,-8)(8,0)(8,8) 3x-1. 5Write an equalion andsolve for x if the arcaof the rectangle is 55square units. What are the raw materials (reactants/goes into) for photosynthesis?A. water and glucoseB. carbon dioxide and water C. glucose and oxygen On June 30, 2024, L. N. Bean issued $30 million of its 8% bonds for $28 million. The bonds were priced to yield 10%. Interest is payable semiannually on December 31 and July 1. If the effective interest method is used, how much bond interest expense should the company report for the 6 months ended December 31, 2024