Answer:
Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.
Explanation:
BRAINLIEST PLZZZZZZ
Size-wise, your heart occupies about_____ of the space in your upper chest.
A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th
Answer:b
Explanation:
Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.
What is heart?Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.
The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.
Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.
To learn more about heart, refer to the link below:
https://brainly.com/question/16566688
#SPJ2
Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.
For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.
After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.
Answer:
Focus on the issue, not the person. ...
Be genuine rather than manipulative. ...
Empathize rather than remain detached. ...
Be flexible towards others. ...
Value yourself and your own experiences. ...
Use affirming responses.
Meet regularly. Hold regular strategy meetings for the entire team. ...
Be inclusive. ...
Be transparent, clear and concise. ...
Show some respect. ...
Recognize that being right may be wrong. ...
Use online collaboration tools.
Explanation:
''.''
Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane
NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
why are technical schools established?
Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional
Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)
Answer:
i put an answer but someone deleted it
Explanation:
Solve: -3x+1<-5
X>
X> 2
4
x<-2
Sylvester is dealing with hearing loss. The doctor informs him that his basilar membrane is damaged. What type of hearing loss is Sylvester experiencing
Cochlear Hearing Loss
Explanation:
How do blood types react in a transfusión ?
Answer:
person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.
Explanation:
person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.
