What is the length from Alaska to Chicago times 5 divided by 3?

Answers

Answer 1

Answer:

14302 miles

Step-by-step explanation:

from alaska to chicago it is 2861 mi.

2861 times 5

that divdied by three is 14302


Related Questions

write a real world problem that could be represented by 1/5 x 5 = 1

Answers

Answer:

Each person received 1/5 of a pizza. There were 5 people in total. How much pizza was there originally before the split?

For every four female students in a training class, there are two men. There are seven male students. What is the total number of students in cass?

Answers

Answer:

it may be 19 or 20 but I may be wrong

Step-by-step explanation:

sorry if I'm wrong

4-(6x1000)+99-490=
i need u guys help and thank you

Answers

Answer:

-6387

Step-by-step explanation:

I have a feeling you're just giving away points :)

what is the product of 4/5 and 6/7

Answers

I believe your answers gonna be 9/14

does anyone know this

Answers

Answer: 761 yd

split the figure into different pieces to make it easier

(23 x 7) + (40 x 15)

161 + 600

761

hope this helped :)

Answer:

761 yd ^3

Step-by-step explanation:

Don uses a funnel to pour oil into his car engine. The funnel has a radius of 6 cm and a slant height of 10 cm. How much oil, to the nearest cubic centimeter, will the funnel hold.

Answers

This funnel will hold approximately  2387.61    the volume of oil that the funnel can hold is approximately  2387.61 ?

Please help!!! These are the options
From the table Riley is moving forward on the interval [0,
A.4.5 B. 1.5 C.3 D.6.
It takes Riley A.3 B.4.5 C.6 D.1.5 seconds to swing forward,back and then return to her standing position. Riley reaches a maximum distance of A.6.75 B.38.9 C.1.5 D.55 inches of her starting position.

Answers

Answer:

From the table, Riley is moving forward on the interval [0,1.5].

I takes Riley 6 seconds to swing forward, back, and then return to her starting position.

Riley reaches a maximum distance of 38.9 inches from her starting position.

Step-by-step explanation:

PLATO/Edmentum

The blanks in the given statements can be filled as [0,1.5], 3 seconds, and 55 inches, respectively.

What is a table?

Mathematical tables are collections of numbers that display the outcomes of calculations made using various inputs.

Given that in the table the position of Riley with respect to time. Also, If her position is ahead of its initial position it is positive, while if she is behind her initial position it is negative.

Now as per the table, the statements can be completed as,

Riley is moving forward on the interval [0, 1.5]It takes Riley 3 seconds to swing forward, back, and then return to her starting position.Riley reaches a maximum distance 55 of Inches from her starting position.

Hence, the blanks in the given statements can be filled as [0,1.5], 3 seconds, and 55 inches, respectively.

Learn more about Table here:

https://brainly.com/question/10670417

#SPJ2

Name the song that goes with these lyrics
1. I was rocking off white tryna have a fun time she gone eat like lunch time molly got her on time
2. Im a first class baby u in last baby im a 90's baby but i cook that shi from the 80's
3. I know i have a purpose but ion see the purpose they tell me the death of me gone be the perkys i know the lace the ills i bought them on purpose lifes unreal when deaths uncertain

Answers

Answer:

1. I'll Be Fine - Juice Wrld

2. ON GOD - Juice Wrld

3. Rich and Blind - Juice Wrld

Which equation shows how to find the
angle measure of the part of the circle
without the arrow?

Answers

B because it can be A since a circle is 360 degrees and an arrow is only 90 degrees so that is why i think B

the age of three sibling leon,kelly,and jack are in the ratio 3: 5: 6:. the sum of their age is 42 years.how old is kelly?​

Answers

Kelly would be 32 years old

Hey, can someone please help me? I’m pretty sure the answers are B and D but I just wanna make sure.

Answers

Answer:

yes b and d

Step-by-step explanation:

Wayne Gretsky scored a Poisson mean six number of points per game. sixty percent of these were goals and forty percent were assists (each is worth one point). Suppose he is paid a bonus of 3K for a goal and 1K for an assist. (a) Find the mean and standard deviation for the total revenue he earns per game. (b) What is the probability that he has four goals and two assists in one game

Answers

Answer:

a) The mean for the total revenue he earns per game is of 13.2K while the standard deviation is of 3.63K.

b) 0.05 = 5% probability that he has four goals and two assists in one game

Step-by-step explanation:

In hockey, a point is counted for each goal or assist of the player.

In a Poisson distribution, the probability that X represents the number of successes of a random variable is given by the following formula:

[tex]P(X = x) = \frac{e^{-\mu}*\mu^{x}}{(x)!}[/tex]

In which

x is the number of sucesses

e = 2.71828 is the Euler number

[tex]\mu[/tex] is the mean in the given interval. The standard deviation is the square root of the mean.

(a) Find the mean and standard deviation for the total revenue he earns per game.

60% of six are goals, which means that 60% of the time he earned 3K.

40% of six are goals, which means that 40% of the time he earned 1K.

The mean is:

[tex]\mu = 6*0.6*3 + 6*0.4*1 = 13.2[/tex]

The standard deviation is:

[tex]\sigma = \sqrt{\mu} = \sqrt{13.2} = 3.63[/tex]

The mean for the total revenue he earns per game is of 13.2K while the standard deviation is of 3.63K.

(b) What is the probability that he has four goals and two assists in one game

Goals and assists are independent of each other, which means that we find the probability P(A) of scoring four goals, the probability P(B) of getting two assists, and multiply them.

Probability of four goals:

60% of 6 are goals, which means that:

[tex]\mu = 6*0.6 = 3.6[/tex]

The probability of scoring four goals is:

[tex]P(A) = P(X = 4) = \frac{e^{-3.6}*(3.6)^{4}}{(4)!} = 0.19122[/tex]

Probability of two assists:

40% of 2 are assists, which means that:

[tex]\mu = 6*0.4 = 2.4[/tex]

The probability of getting two assists is:

[tex]P(B) = P(X = 2) = \frac{e^{-2.4}*(2.4)^{2}}{(2)!} = 0.26127[/tex]

Probability of four goals and two assists:

[tex]P(A \cap B) = P(A)*P(B) = 0.19122*0.26127 = 0.05[/tex]

0.05 = 5% probability that he has four goals and two assists in one game

PLS AWNSER I WILL GIVE BRAILIEST

Answers

suzy will be walking around the circumfernnce of the fountain

circumfernce= [tex]2\pi r[/tex]

r is half of the diameter so it will be 5

[tex]2\pi (5)=31.4[/tex]

as she walks around it 3 times it will be

[tex]31.4 *3 = 94.2 feet[/tex]

so the answer is H. 94.2 feet

please mark as brainliest

Please help I’ll mark you as brainliest if correct!

Answers

Answer:

The wright answer is 16.33 inches

PLEASE HELP!! ....................... URGENT

Answers

Answer:

I got an F- on math soo i cannot help i am sorry

Step-by-step explanation:

.-.

is 1 5/6 a rational number or a iraarational

Answers

Answer: rational number

Step-by-step explanation:

Mixed numbers are all rational numbers because they can be expressed as a fraction. To be a rational number, a number must be able to be written

Find the perimeter and area of the rectangle.
20 ft
7 ft
The perimeter is
ft and the area is

Answers

Answer:

Area is 140 ft2

perimeter is 54 ft

Answer:

54 and 140

Step-by-step explanation:

If the lengths are 20ft and 7ft, then you can just add 20+20+7+7, which equals 54.

The area is 140, because if you multiply 20 by 7, thn you get 140.

Hope that this helps!

7a +5+2b
Select all of the true statements below.
- 2b and 5 are like terms.
- 5 is a constant.
- 2 is a coefficient.
- 7a+5+2b is written as a product of three factors.
- 7a +5+2b is written as a sum of three terms.
- None of these are true.

Answers

Answer:

5 is a constant

2 is a coefficient

7a + 5 + 2b is written as a sum of three terms

PLSSSS HELP ME ALOT OF CREDITS AND BRAINLIST IF YOU HELP ME!!!!!

Answers

G. A. B. O

By probability in the chart, it goes from most to least that is grapes, apples, bananas and oranges

Find the volume of a cone with a base diameter of 8 in and a height of 6 in. Write the exact volume in terms of pi, and be sure to include the correct unit in your answer.​

Answers

Volume of a cone = pi x r^2 x h/3

Volume = pi x 4^2 x 6/3

Volume = 32pi cubic inches ( in.^3)

Find the range of the data

5,9,13,6,4,5,8,12,12,6

Answers

Answer:

9

Step-by-step explanation:

highest value: 13

lowest value: 4

13-4= 9 which is the range

Answer: 9

Step-by-step explanation: 13-4=9

A rectangular prism has a square base with side
the prism is 5 feet. What is the volume of the prism? Show you
m has a square base with sides that are 2 feet long. The height of
Please help

Answers

Answer:

The formula for the volume of a prism is V=Bh , where B is the base area and h is the height. The base of the prism is a rectangle. The length of the rectangle is 9 cm and the width is 7 cm.

Step-by-step explanation:

safari

Suppose that $10,083 is invested at an interest rate of 6.8% per year, compounded continuously.

a) Find the exponential function that describes the amount in the account after time t, in years.

b) What is the balance after 1 year? 2 years? 5 years? 10 years?

c) What is the doubling time?

Answers

Answer:

a) The exponential function is [tex]A(t) = 10083(1.068)^t[/tex]

b)

The balance after 1 year is of $10,768.644

The balance after 2 years is of $11,500.91

The balance after 5 years is of $14,010.25.

The balance after 10 years is of $19,467.15

c)

The doubling time is of 10.54 years.

Step-by-step explanation:

Continuously compounded interest:

The amount of money earning after t years, with interest compounded continuously, is given by:

[tex]A(t) = A(0)(1+r)^t[/tex]

In which A(0) is the amount of the initial investment and r is the growth rate, as a decimal.

a) Find the exponential function that describes the amount in the account after time t, in years.

Suppose that $10,083 is invested at an interest rate of 6.8% per year

This means, respectively, that [tex]A(0) = 10083, r = 0.068[/tex]

So

[tex]A(t) = A(0)(1+r)^t[/tex]

[tex]A(t) = 10083(1+0.068)^t[/tex]

[tex]A(t) = 10083(1.068)^t[/tex]

b) What is the balance after 1 year? 2 years? 5 years? 10 years?

After 1 year:

[tex]A(1) = 10083(1.068)^{1} = 10,768.644[/tex]

The balance after 1 year is of $10,768.644

After 2 years:

[tex]A(2) = 10083(1.068)^{2} = 11,500.91[/tex]

The balance after 2 years is of $11,500.91.

After 5 years:

[tex]A(5) = 10083(1.068)^{5} = 14,010.25[/tex]

The balance after 5 years is of $14,010.25.

After 10 years:

[tex]A(10) = 10083(1.068)^{10} = 19,467.15[/tex]

The balance after 10 years is of $19,467.15.

c) What is the doubling time?

This is t for which [tex]A(t) = 2A(0)[/tex]. So

[tex]A(t) = A(0)(1.068)^t[/tex]

[tex](1.068)^t = 2[/tex]

[tex]\log{(1.068)^t} = \log{2}[/tex]

[tex]t\log{1.068} = \log{2}[/tex]

[tex]t = \frac{\log{2}}{\log{1.068}}[/tex]

[tex]t = 10.54[/tex]

The doubling time is of 10.54 years.


What is the cost with sales tax for the phone? Assume that the sales tax is 6%, or 0.06 times the price.

Answers

Answer:

$0.06x

Step-by-step explanation:

Well, you didn’t give us a value for the phone so let’s say the phone is x. . .

Let x=the price of the phone.

x * 0.06=0.06x

Answer:

Step-by-step explanation:

a

PLEASE HELP ME ASAP!!!!!!
The length of a house on a blueprint is 4 inches, and the building itself is 32 feet long. If the width of the house is 40 feet, how wide is it on the blueprint?
28 in.
5 in.
10 in.
8 in.

Answers

Answer:

10 inches

Step-by-step explanation:

10 inches :)):)):):):):);):);)

A red die and a blue die are rolled. You win or lose money depending on the sum of the values of the two dice. If the sum is 6 or 10, you win $4. If the sum is 5, 9, or 12, you win $1. If the sum is any other value (2, 3, 4, 7, 8, or 11), you lose $2. Let X be a random variable that corresponds to your net winnings in dollars. What is the expected value of X

Answers

Answer:

The expected value of X is $0.0833.

Step-by-step explanation:

A probability is the number of desired outcomes divided by the number of total outcomes.

For each dice, there are 6 possible outcomes(values from 1 to 6). So for 2 dices, there are [tex]6^2 = 36[/tex] desired outcomes.

Desired outcomes:

Sum 5: (1,4), (2,3), (3,2), (4,1).

Sum 6: (1,5),(2,4),(3,3),(4,2),(5,1)

Sum of 9: (3,6), (4,5), (5,4), (6,3)

Sum of 10: (4,6), (5,5), (6,4)

Sum of 12: (6,6)

Probabilities:

5 + 3 = 8 outcomes in which the sum is 6 or 10, that is, 8/36 probability of winning $4.

4 + 4 + 1 = 9 outcomes in which the 5, 9, or 12, that is, 9/36 probability of winning $1.

36 - (8 + 9) = 36 - 17 = 19 remaining outcomes, that is, 19/36 probability of losing $2.

What is the expected value of X?

Multiplication of each outcome by its probability. So

[tex]E(X) = \frac{8}{36}*4 + \frac{9}{36}*1 - \frac{19}{36}*2 = \frac{8*4 + 9*1 - 19*2}{36} = \frac{32 + 9 - 38}{36} = \frac{3}{36} = 0.0833[/tex]

The expected value of X is $0.0833.

the question is in the picture.

Answers

Answer:

Team 1

Step-by-step explanation:

I think it is team 1 because their whiskers go through the whole graph and team 2 only goes from 68 to 76

Answer:

team 1

Step-by-step explanation:

help pls
750000 + 4000 x 4%

Answers

750000+4000 x 4% is 750160

Answer:

750160 ez

Step-by-step explanation:

The side length of thr hexagon is 16 centimeters,and the length of the digonal shown is 32 centimeters. Charles measured the height of one of trapezoids and found that the height of one of the trapezoids and found that the height was 13.9 centimeters. Find the area of the hexagon.

Answers

Answer:

669cm2

correct question

Charles drew a regular hexagon and divided it into two identical trapezoid , the side length of the hexagon iscoming16cm,the diagonal shown in fig 30 is 32 cm Charles measure the height of one the trapezoid and found that the height was 13.9 cm find the area of the area

Step-by-step explanation:

The side length of the hexagon should be given which is 16 cm

To get the Length the side length makes with the height of the trapezium, Pythagoras theorem is applied to get the base of the triangle

Base = √((16)^2 - (13.9)^2

Base = √62.29

Base = 7.92cm

Since we have gotten the base

Diagonal - the base gives the top length of the trapezium.

32- 7.92- 7.92 = 16.16

The area of the hexagon gives the 2 times of the trapezium.

To find the area of the trapezium

= 1/2 * ( a+b)h

= 1/2* ( 32+ 16.16)* 13.9

= 24.04*13.9

Area of the trapezium = 334.71cm2

= 334.71 * 2

= 669.42cm2

Hope this helps

Can someone please help me with Systems of Equation. If so please comment here and friend me at fmilluzionz#1521. I am in 8th grade math

Answers

Answer:

The FitnessGram PACER Test is a multistage aerobic capacity test that progressively gets more difficult as it continues. The test is used to measure a student's aerobic capacity as part of the FitnessGram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound.

Step-by-step explanation:

Other Questions
can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. y321-4-3 -2-112234-1+-2+-3+-4What is the slope of the line? Help please thank you:) QUICKLY!!!!!!!!! The Dust Bowl of the 1930s was caused by_______(choose multiple answers) earthquakesvolcanic eruption erosion overgrazing the clearing of grasslands fertilizer runoff The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond